Arinaitwe, Warren

Dominguez, Viviana

Jimenez, Jenyfer

Leiva, Ana Maria

Pardo, Juan Manuel

Rodriguez, Rafael

CGSpace

Pre-emptive disease managementCrop ProtectionCassava Program Retreat - ColombiaFebruary - 2023Crop Protection TeamAna Maria LeivaJenyfer JimenezJuan Manuel PardoRafael RodriguezWarren ArinaitweViviana DominguezCWBDJuan Manuel: CWBD in SEA first response and early observationsWarren A: Disease biologyAna Maria: BioinformaticsCBB Juan Manuel/Rafael R: Models for resistancescreeningCFSD –Jenyfer/Wilmer (10mins)CBSD – Xiaofei Zhang (10mins)Q&A (20mins)Some notes on microbes• Globally they are not equally distributed, most do not cause disease• Those that do are professional party spoliers – evolving and moving• We need pathogen genomic information to correctly identified them• Is field diagnostics something to go for? (Nothing beats PCR yet)• Going beyond first cases – study the dissemination scenarios (Geo location, vectors, climate)Monitoring platformhttps://pestdisplace.orgCMD in Asia – last 15 yearsCFSD – last 50 yearsCBSD – last 80 yearsCassava common mosaic disease – last 3 yearsReal-time tracking of cassava common mosaic virus (RdRp gene)Wilmer J. Cuellar 2021TR4 – last 15 yearsCassava Witches’ Broom Disease (CWBD)Juan M. Pardo, Warren Arinaitwe, Ana M. LeivaThe CWB disease begin….   In May 2004, a survey for plant diseases caused by viruses and virus-like pathogens was made in the French Pacific territory of Wallis and Futuna by the SPC and the Wallis and Futuna Service de l’agriculture.Source: Personal communication with Richard Davis, Plant Pathologist - Northern Australia Quarantine Strategy (NAQS)Symptoms of witches’ broom (proliferation of axillary buds), yellowing and little leaf.Cassava little leaf AY787139 99% to aster yellows strain CHRY (AY180950) ‘Ca. Phytoplasma asteris’ (16SrI)During more than 10 years…..The CWB disease in SEA was observed during 2008-2009CMD in SEA emerged after a ‘first wave’ of CWBD• 2010: CWBD incidence ~80% in Yen Bai, Quang Ngai and Dong Nai (north, central and south Vietnam)• 2012: CWBD incidences of 30-40% in Cambodia in the provinces of Kampong Cham, Kratie and Prey Veng.• 2012: field surveys in Chachoengsao and Rayong in southern Thailand, report similar “high incidences” of CWBD.• 2014: average incidence of CWBD in SEA 32% (highest in Cambodia, 46%)Pre-emptive disease management in SEA Cassava Retreat 2023, Warren Arinaitwe• What do we know?• What are we doing?• Next steps Focus: CWBD, Bemesia tabaciCWBD DistributionEarly-Mid season 2020-2021Field situation Dec  2022Establishment of  prerequisite infrastructure New insect-proof screen houseNew molecular laboratory 18 M2Old workspace   94.5 M2New workspace   Understanding the impact of  CWBD on phenotypeCWBD significantly limits the photosynthetic capacity of cassava Can CWBD be transmitted by grafting?Optimisation of CWBD DNA extraction, detection, symptom-pathogen association CWBD pressure changes with plant growth stageField experiments Warren, LaoThao, Rithand Imran Whitefly surveillance   WF Abundance 202220212020Mean abundance2020Abundance Abundance 2021………Whitefly population building up!2021………High-throughput sequencing (HTS) methodshttps://nextstrain.org/community/pestdisplace/CMDASIA2Comparative Metagenomic in CWBSample Stem S1 Asymptomatic S2 Asymptomatic S3 Asymptomatic S4 SymptomaticS5 SymptomaticS6 Symptomatic0102030405060708090100S1 S2 S3 S4 S5 S6Percentage of reads Host MicroorganismsExperiment using whole genome sequencing  (Hiseq illumine). comparison of asymptomatic with symptomatic plants. Produce more than 2 billion of reads per sample.Barplots showing the relative abundance of different taxons in six samples from stem cassava. S1-S3: Asymptomatic stem. S4-S6: Symptomatic stem with witch's broom disease. Barplot A shows the relative abundance of different genus. Barplot B shows the relative abundance of different phylum. Notice that only in Symtomatic samples we find Basidiomycota. Y: Abundance classified    X: Samples.    Barplot: Relative frequency classified  A BDesigner of primers to detection and using ITS region to classify the fungal 3 set of Primers Forward ReverseCerato1GGTTGATTGCCCAGGGACTGC CTTGTACTGCGAGCTCTCACGCerato2 GGATGAGTTTAATCGCTCTAAC GCGCTCTGGTGTTTCAAGTTTGCerato3 CGTCGTTGGGCTAGTTATTGC CGTATCCCCTAGCCATGGAAC AF153800AF354108 Thanatephorus cucumerisAB000004 Rhizoctonia solaniAB000003 Rhizoctonia solaniAF153804 Rhizoctonia solani H1AB290017.1 Ceratobasidium sp. AG-EAJ427407.1 Ceratobasidium sp. AGRAB000019 Rhizoctonia solani HG-IAY154313 Thanatephorus cucumeris AG-11AB122133 Thanatephorus cucumerisAB286940 Ceratobasidium sp. AG-PAB196647.1 Ceratobasidium sp. AG-GAB196653.1 Ceratobasidium sp. AG-LAB122145.1 Ceratobasidium sp. AG-KAB196659.1 Ceratobasidium sp. AG-TCassava SampleHQ424246 Ceratobasidium theobromae Sulawesi-10AB196649.1 Ceratobasidium sp. AG-HAB196650.1 Ceratobasidium sp. AG-IAB290021.1 Ceratobasidium sp. AG-CAB286930 Ceratobasidium sp. AG-BaAF354095.1 Ceratobasidium sp. AGQDQ102430.1 Ceratobasidium sp. AG-BAB198702.1 Ceratobasidium sp. AG-DAY684917 A. rolfsii9968991007596892843475952594954564099371611510.05A. Primer design using geneious program B. Phylogenetic tree using the Neighbor-Joining method. The associated taxa clustered together in the bootstrap test (1000 replicates) are shown next to the branches. The evolutionary distances were computed using the Maximum Composite Likelihood method. All positions containing gaps and missing data were eliminated. There were a total of 556 positions in the final dataset. Evolutionary analyses were conducted in MEGA.A. B.Sequencing of Ceratobasidium from cassava Cassava Bacterial Blight (CBB)Juan M. Pardo, Rafael RodriguezBacterial Blight disease progression, using machine-learning image analysis 1. Isolate Xantohomonas phaseoli pv. manihotis(Xpm)  2. Confirm the Xpm identity(Bernal-Galeano et al., 2018)3. Prepare the inoculum: 3 days at 25˚C, dilution 0.01 OD600   5. Inoculation through infiltration, 3 technical replicates per strain onto the leaf lobe      6. Three infiltration per lobe, central three lobes used, each lobe is a different strain.     Per plant one leaf inoculated: Lobe 1: CIO 81Lobe 2: CIO 59Lobe 3: Control (Water) Per strain 3 plants 4. Choose the three leaf from4–5-week-old cassava plants7. Measure the spot area advance: phenotyper –Machine learning Measure in following days: 0, 4, 6, 9,12, Analyze data on RDaily AUDPC advance    Relative humidity=80%Day/night temperature=28/19˚C CIO59                            CIAT1075                                                                             0.01 Abs                                                                                                   0.05 Abs                                                                                     Data analysis Strain Edaphoclimatic zonesCIO 59 1-Subhumid tropics* CIAT 1075 5-High altitudeStrain*Verdier et al., 2000Susceptibility  test • Experimental design: Split plots . (genotypes,  strains, three replicates, 9 observations per strain X Genotype). Negative control MgCl. Pr(>F)0.69515Pr(>F)0.00004Perspectives   Cassava root rot https://www.flickr.com/photos/iita-media-library/7656614828/in/photostream/lightbox/Detached storage roots of cassava A. Negative control B.Inoculated root with Phythophtora spp. The arrows point tothe inoculation site and disease development region.Source:  Medeiros-Lima et al., 2018 https://doi.org/10.1016/j.pmpp.2018.09.001Ten days after inoculation, the total area colonized by the pathogen on the root pulp could be evaluated by digital image analysisOutlineWhy is this topic important; what are the key research findings; • Whitefly maps, low incidence, Asia II 1; CWBD incidences, no phytoplasma detection (Warren)• Ampelloviruses global distribution, Cassava common mosaic virus, Secovirids (Jenyfer)• Diagnostics for circular DNA (cassava geminiviruses)• Validate ‘super’ technologies (field sequencing, lamp, smartphones for disease dx)-prevenir gastowhat are already out the outcome level and ready for scaling; • Circular DNA detection• Microbiome analysis• Cassava pathobiome detection• PestDisPlace•what are the emerging questions and priorities. • Accelerate stakes/genotype availability• Models for resistance identification• Endemic versus introduced pathogens and transcontinental movement of seeds• Identification of resistance-breaking strains• Vector identification – management of disease transmission• Yield impact  (experimental plots) for risk analysisWhat next?• Regional-wide  symptom-pathogen association studies• Extensive transmission studies  • Intercellular pathogen localisation studies • ……. management optionsCassava Frogskin Disease (CFSD)Jenyfer JimenezTransmissionVector aéreo00.511.522.533.544.55Control CFSDKg/plantInjertoSano Cuero de Sapo> 70%3er añoWilmer J. Cuellar 2022DistributionCFSD at CIATEcu72Bra1A CR46 Per183CR44CMC40 10/10 10/1010/1010/101/100/10Wilmer J. Cuellar 2022Alcalá-Briseno et al., in preparationNetwork analysis – virus x countryField work is where plant pathology begins!Support projects that involve large scale pathogen surveillance activitiesHarmonizing protocols for nucleic acids extraction and field sample collectionsDetection and characterization of cassava virusesGuarantee consistent resultsDistribution and diversity of a SecoviridCP-RNA2QMV48119.1 CsTLV0760-F BrazilUAW09557.1 CsTLV-Yop12QMV48117.1 CsTLV0149-F BrazilAII20257.1 Corr6A ArgentinaAHI59117.1 Mbra383 ColombiaAHA91818.1 CM5460-10AWW14955.1 Sec13AHI59118.1 SM909-25QMV48118.1 CsTLV0359-F BrazilNP 620569.1 Apple latent spherical virus98670.23 Meta-20224 Arauca-2022516 Peru-2016MZ962208.1 Cas-37MZ962209.1 Cas-56514 Peru-2016635 Peru-2016MZ962210.1 Met-33MZ962206.1 Cas-4735 Peru-201671 Peru-2016MZ962211.1 Met-35MZ962207.1 Cas-11271 Peru-2016MZ962212.1 Met-36MF449527.1 FSD23MF449528.1 CM5460-10-5576 Peru-2016668 Peru-2016MF449524.1 Fsd80MF449525.1 Fds5MF449530.1 CM5460-10CsTLV Yop12MF449529.1 Ecu72CSTLV-Sec1370100978557780.05RdRp-RNA1Phylogenetic trees generated using Neighbor-Joining method and the a.a. sequences of RdRpand CP domain.The evolutionary distances were computed usingthe Poisson correction method and are in the unitsof the number of a.a. substitutions per site.Manihot esculenta-associated virus 1 and 2(MEaV-1 and MEaV-2)Field surveys (2016) and germplasm collections (2015-2017)Source: Kwibuka et al., (2021)Location of degenerated primers designedSequence alignment of MEaV-1 and MEaV-2MEaV-1CG-NmbMG-Men-9MEaV-2Phylogenetic relationship of ampeloviruses based on the Helicase domain (a.a) of the isolates from Africa, Asia and Latin America.The evolutionary history was inferred using the Neighbor-Joining method and the distances were calculated using Poisson model.The tree was generated using MEGA v6.Phylogenetic analysis of cassava isolates of MEaV-1 and MEaV-2MalawiPeruVietnamLaosMAL-29MT773586 Manihot esculenta associated ampelovirus 1 isolate RE-LjvMAL-2LIM-103 MT773584 Manihot esculenta associated ampelovirus 1 isolate MG-Men-241MAL-3 MAL-37MAL-120HUA-31 JUN-43 Asia-V48MAL-80MW929099 Cassava ampelovirus1 isolate Malawi 14MW929100 Cassava ampelovirus 1 isolate Brazil 20 Asia-F81Asia-S2Asia-26 Asia-1Asia-38 Asia-46 Asia-F72MT773596 Manihot esculenta associated ampelovirus 2 isolate MG-Mian-2-2 MT773591 Manihot esculenta associated ampelovirus 2 isolate MG-Men-9MT773594 Manihot esculenta associated ampelovirus 2 isolate MG-Mia-362 MT773592 Manihot esculenta associated ampelovirus 2 isolate MG-Mia-10NC 011702 Grapevine leafroll-associated virus 10 NC 010178 Pineapple mealybug wilt-associated virus 1 1007610010010066656554MEaV-1MEaV-2Cassava Brown Streak Disease (CBSD)Zhang, XiaofeiCassava Mosaic DiseaseCassava Brown Streak Disease Cassava Witches’ Broom Disease Cassava Frogskin DiseaseImmunity to CBSV from LAC to SSA maternal paternal numberPER353 GM7673 4GM10054B PER353 6GM10054B PER353 8GM10055B PER353 3GM10062 PER353 3C33 PER353 5C39 PER353 5C243 PER353 5C413 PER353 4GM10054B PER221 8C33 PER221 5GM6127 PER221 8GM7672 PER221 15COL144 GM7673 4COL144 GM10055B 3COL144 GM10055B 8COL144 C33 6COL144 C39 3COL144 C19 54COL144 C39 195COL144 TME3 42KBH2016B TME14 23COL40 C33 3COL40 KBH2016B 17COL40 KBH2016B 8COL40 TME14 103COL40 GM6127 21COL40 57ECU41 8634Breeding populations at PYT stage in Tanzania and Uganda in 2023.Identify the pathogen and resistance donorsResist.Resist.Pre-emptive breedingIdentify the pathogen and resistance donorsResist.Resist.Resist.Thanks!Questions?Notes • Identifying tolerant/resistant varieties against CMD in the current context (i.e. consider CWBD)• Timely detection of resistance-breaking strains (e.g. African geminiviruses)• Raise awareness on other cassava transboundary pests and diseases• Monitoring of whitefly abundance• Harmonize quarantine and seed movement protocols• Establish disease models (biological and epidemiological) for risk and impact analyses• Access to Biosafety Level 2-3 facilities?

Pre-emptive disease management

https://cgspace.cgiar.org/bitstream/10568/131644/1/Pre-emptive%20disease%20management-1.pdf

Pre-emptive disease management

Abstract

Similar works

Full text

Available Versions

CGSpace