Germline stem cell proliferation in C. elegans requires activation of the GLP-1/Notch receptor, which is located on the germline plasma membrane and encoded by the glp-1 gene. We previously identified several genes whose products directly or indirectly promote activity of the GLP-1 signaling pathway by finding mutations that enhance the germline phenotype of a glp-1(ts) allele, glp-1(bn18) . Here, we report phenotypic and molecular analysis of a new ekl-1 allele, ekl-1(om92) , that enhances the glp-1(bn18) phenotype. ekl-1(om92) is a 244 bp deletion predicted to generate a frameshift and premature termination codon, yielding a severely truncated protein, suggesting it is a null allele

Lissemore, James L.

Maine, Eleanor M

O\u27Connell, Kevin F

Smith, Harold E

Spoerke, Jill M

Stein, Samantha A

Zucaro, Olivia F

English

PubMed

John Carroll University

John Carroll University Carroll Collected 2022 Faculty Bibliography Faculty Bibliographies Community Homepage 2022 om92, a glp-1 enhancer mutation, is an allele of ekl-1 Samantha A. Stein Olivia F. Zucaro Harold E. Smith Kevin F. O'Connell Jill M. Spoerke See next page for additional authors Follow this and additional works at: https://collected.jcu.edu/fac_bib_2022  Part of the Biology Commons Authors Samantha A. Stein, Olivia F. Zucaro, Harold E. Smith, Kevin F. O'Connell, Jill M. Spoerke, Eleanor M. Maine, and James L. Lissemore  om92, a glp-1 enhancer mutation, is an allele of ekl-1Samantha A. Stein1*, Olivia F. Zucaro1*, Harold E. Smith2, Kevin F. O'Connell3, Jill M. Spoerke4, Eleanor M. Maine4, JamesL. Lissemore1§1Biology Dept., John Carroll University, University Heights, OH USA2National Institute of Diabetes and Digestive and Kidney Diseases, National Institutes of Health, Bethesda, MD USA3Laboratory of Biochemistry and Genetics, National Institutes of Diabetes and Digestive and Kidney Diseases, NIH, Bethesda,MD USA4Biology Dept., Syracuse University, Syracuse, NY USA§To whom correspondence should be addressed: jlissemore@jcu.edu*These authors contributed equally.AbstractGermline stem cell proliferation in C. elegans requires activation of the GLP-1/Notch receptor, which is located on thegermline plasma membrane and encoded by the glp-1 gene. We previously identified several genes whose products directly orindirectly promote activity of the GLP-1 signaling pathway by finding mutations that enhance the germline phenotype of aglp-1(ts) allele, glp-1(bn18). Here, we report phenotypic and molecular analysis of a new ekl-1 allele, ekl-1(om92), thatenhances the glp-1(bn18) phenotype. ekl-1(om92) is a 244 bp deletion predicted to generate a frameshift and prematuretermination codon, yielding a severely truncated protein, suggesting it is a null allele. 11/30/2022 - Open Access Figure 1. glp-1(bn18) enhancer allele om92 disrupts germline function and is likely a null allele of the ekl-1 gene: 11/30/2022 - Open Access (A) DIC images of representative germlines from young adult hermaphrodites of the indicated strains raised at 20 °C.Asterisks indicate the distal tip cell. Arrows indicate location of sperm. Arrowheads indicate location of oocytes. (B)Fluorescence images of representative DAPI-stained germlines from young adult hermaphrodites of the indicated strainsraised at 20 °C. Marking symbols are the same as in (A). (C) Screenshot of ekl-1 gene location on LG I and gene organizationfrom Wormbase (WS285, https://wormbase.org) indicating location and length of the ekl-1(om92) deletion. (D) Partialsequence alignment of ekl-1(om92) and ekl-1(+) genomic sequence indicating precise extent and location of the ekl-1(om92)deletion. Exon sequences are uppercase while intron sequences are lowercase. WT, wildtype. (E) Schematic diagram ofpredicted proteins encoded by ekl-1(om92) (above) and ekl-1(+) (below). Red boxes in the predicted wildtype EKL-1 proteinindicate locations of Tudor domains according to UniProt (Release 2022_03, https://www.uniprot.org/). The black box in thepredicted mutant EKL-1 protein indicates the extent of the amino acid sequence changes caused by the ekl-1(om92) deletionand resulting frameshift. The C-terminal amino acid sequence resulting from the frameshift (after residue T81) is shown. Thepredicted length of the mutant EKL-1 protein is 100 amino acids, and the wildtype protein is 606 amino acids.DescriptionWe have reported the identification of numerous genes that promote GLP-1/Notch signaling in the C. elegans germlinethrough genetic analysis of EMS- and UV/TMP-induced mutations in a sensitized genetic background. Specifically, we havefound a series of ego (enhancer of glp-one) alleles that genetically enhance the reduced germline proliferation observed in atemperature-sensitive allele of glp-1, glp-1(bn18) (Qiao, et al., 1995; Smardon, et al., 2000; Liu and Maine, 2007; She, et al.,2009; Lissemore, et al., 2018). Molecular characterization of these ego alleles revealed genes that directly or indirectlypromote GLP-1/Notch signaling, including the transcriptional regulator lag-1, cell cycle regulatory genes cye-1 and cdk-2, andseveral genes encoding small RNA machinery components (drh-3, ekl-1, ego-1), among others (Qiao, et al., 1995; Smardon, etal., 2000; She, et al., 2009; Fox, et al., 2011). We present here molecular and phenotypic analysis of another allele from ourpreviously reported UV/TMP screen for ego alleles, om92.Wildtype young adult hermaphrodites have active germline proliferation (i.e., a progenitor zone) in the distal gonad arm(Figure 1A and 1B). As germline cells move proximally, they enter meiosis and in adults undergo oogenesis; oocytes maturein the proximal region prior to fertilization in the spermatheca. unc-32(e189) glp-1 (bn18) young adult hermaphrodites at 20°C have reduced GLP-1 signaling, leading to a reduced progenitor zone compared to wildtype (Figure 1A and 1B). unc-32(e189) is tightly linked to glp-1 and is used here as a marker for the presence of glp-1(bn18). The overall organization of theglp-1(bn18) germline at 20 °C is the same as in wildtype although the size is somewhat smaller. Young adult hermaphroditeshomozygous for om92, a UV/TMP-induced mutation, are sterile but have a substantial germline (Figure 1A and 1B). Thedistal region contains a progenitor zone, and more proximal germ cells undergo meiosis, forming sperm and sometimesoocytes; when present, oocytes are small and morphologically abnormal, as in the examples shown here. In addition, someoocytes appear to be aneuploid or to have a chromosome-pairing defect (i.e., > 6 DAPI-bright foci at diakinesis). Spermappear normal and are located in the spermatheca. om92; unc-32(e189) glp-1(bn18) young adult hermaphrodites haveabnormal germlines without distal mitotic cells or meiotic cells, and the size of the germline is correspondingly much smallerthan wildtype (Figure 1A and 1B). Oocytes are absent, and sperm are visible scattered throughout the gonad arm. Based onthis phenotype, it appears the germline progenitor zone was not maintained during larval development; instead, all germ cellsentered meiosis and underwent spermatogenesis prior to young adult stage. Because om92; unc-32(e189) glp-1(bn18)germlines do not retain germline stem cells whereas om92 and glp-1(bn18) single mutant homozygotes do, om92 meets thecriterion for an ego mutation.To determine the molecular identity of om92, we used the one-step whole genome sequencing and SNP mapping method(Doitsidou, et al., 2010) to delimit the mutation to the region between 6.5-7.5 Mbp on chromosome I. Variant calling (Smith, etal., 2016) revealed a single novel candidate mutation within that interval, a 244 bp deletion in the ekl-1 gene, that wasconfirmed by Sanger sequencing of PCR amplicons from om92 homozygotes (Figure 1C and 1D). ekl-1 encodes a Tudordomain protein with multiple known germline functions, including chromosome segregation and small RNA biogenesis andstability (Rocheleau, et al., 2008; Claycomb, et al., 2009; Thivierge, et al., 2011). She, et al. (2009) previously showed, usingRNAi and mutational analysis, that loss of ekl-1 function enhances glp-1(bn18). The om92 deletion removes parts of exons 2and 3 along with all of intron 2 and is predicted to generate a frameshift downstream of codon 81 (Figure 1E, black box inupper figure). Full-length EKL-1 is predicted to include 606 amino acids. In contrast, the truncated EKL-1 protein is predicted 11/30/2022 - Open Access to encode only 100 amino acids and lack both Tudor domains, which have been shown in other organisms to bind tomethylated amino acid residues in histones and other proteins (Lorton and Shechter, 2019), hence it is very likely to be non-functional. Thus, ekl-1(om92) should be considered a null mutation.The phenotype of ekl-1(om92) homozygotes generally resembles the phenotypes reported for ekl-1(om56) and ekl-1(om83)(She, et al., 2009). Specifically, we note the presence of small, abnormal oocytes in a subset of mutants. In addition, She, et al.,2009 noted incompletely penetrant chromosomal pairing defects in the oocytes of ekl-1(om53) and ekl-1(om86), similar towhat we observe here for ekl-1(om92). (These similarities were not noted in the preliminary phenotypic analysis conducted atthe time ekl-1(om92) was isolated, and therefore She et al. did not analyze ekl-1(om92).) We do not, however, observe variablesperm morphology in ekl-1(om92) as She, et al., 2009, reported for ekl-1(om56) and ekl-1(om83). We do not have a definitiveexplanation for the observed phenotypic differences, but they might be attributed to the substantial differences in the predictedprotein products from the different alleles. The ekl-1(om92) predicted protein product contains only 100 amino acids and lacksboth Tudor domains. In contrast, ekl-1(om83) is a deletion mutation resulting in a predicted protein product containing 314amino acids while ekl-1(om56) is a nonsense mutation resulting in a predicted protein product with 318 amino acids. Bothproteins would contain the first Tudor domain which might result in these proteins having some residual function that theprotein encoded by ekl-1(om92) lacks.MethodsNematode strains and worm maintenance:Worms were maintained using standard methods.Microscopy:DIC and DAPI microscopy were carried out essentially as described in Lissemore, et al., 2018.SNP mapping/whole genome sequencing (WGS):Combined SNP mapping and WGS were carried out essentially as described (Smith, et al., 2016) using genomic DNA isolatedfrom om92; unc-32(e189) glp-1(bn18) sterile homozygous worms.PCR and Sanger DNA sequencing:Single worm PCR was carried out on ekl-1(om92) homozygous sterile worms and N2 worms using standard methods. Twodifferent pairs of primers flanking the putative deletion were tested, eklA/eklB and eklC/eklD, and each pair gave the sameresults. Sanger DNA sequencing was carried out by Eton Bioscience, Inc. (San Diego, CA); primers used for PCR were alsoused for sequencing amplicons.ReagentsPrimersPRIMER NAME SEQUENCE (5’-->3’)eklA ATGATTGCGGTTGGACTCCGeklB TGGTCACAGATAATGGGCGAeklC CCGAATCCGGAAGAACCGATeklD GGAGAGAACAACTTCCACACGStrains 11/30/2022 - Open Access STRAIN GENOTYPE AVAILABLEFROMN2 Caenorhabditis elegans CGCJL50 ekl-1(om92)/+ Lissemore LabJL51 ekl-1(om92)/+; unc-32(e189) glp-1(bn18) Lissemore LabJL52 ekl-1(om92) I/hT2[bli-4(e937) let-?(q782) qIs48]; unc-32(e189) glp-1(bn18)/hT2[bli-4(e937)let-?(q782) qIs48] Lissemore LabAcknowledgements: J.L.L. wishes to thank Dr. Geraldine Seydoux, Johns Hopkins School of Medicine, for suggesting thecollaboration with H.E.S.ReferencesClaycomb JM, Batista PJ, Pang KM, Gu W, Vasale JJ, van Wolfswinkel JC, et al., Mello CC. 2009. The Argonaute CSR-1 andits 22G-RNA cofactors are required for holocentric chromosome segregation. Cell 139: 123-34. PubMed ID: 19804758Doitsidou M, Poole RJ, Sarin S, Bigelow H, Hobert O. 2010. C. elegans mutant identification with a one-step whole-genome-sequencing and SNP mapping strategy. PLoS One 5: e15435. PubMed ID: 21079745Fox PM, Vought VE, Hanazawa M, Lee MH, Maine EM, Schedl T. 2011. Cyclin E and CDK-2 regulate proliferative cell fateand cell cycle progression in the C. elegans germline. Development 138: 2223-34. PubMed ID: 21558371Lissemore JL, Connors E, Liu Y, Qiao L, Yang B, Edgley ML, et al., Maine EM. 2018. The Molecular Chaperone HSP90Promotes Notch Signaling in the Germline of Caenorhabditis elegans. G3 (Bethesda) 8: 1535-1544. PubMed ID: 29507057Liu Y, Maine EM. 2007. The Bro1-domain protein, EGO-2, promotes Notch signaling in Caenorhabditis elegans. Genetics176: 2265-77. PubMed ID: 17603118Lorton BM, Shechter D. 2019. Cellular consequences of arginine methylation. Cell Mol Life Sci 76: 2933-2956. PubMed ID:31101937Qiao L, Lissemore JL, Shu P, Smardon A, Gelber MB, Maine EM. 1995. Enhancers of glp-1, a gene required for cell-signalingin Caenorhabditis elegans, define a set of genes required for germline development. Genetics 141: 551-69. PubMed ID:8647392Rocheleau CE, Cullison K, Huang K, Bernstein Y, Spilker AC, Sundaram MV. 2008. The Caenorhabditis elegans ekl(enhancer of ksr-1 lethality) genes include putative components of a germline small RNA pathway. Genetics 178: 1431-43.PubMed ID: 18245826She X, Xu X, Fedotov A, Kelly WG, Maine EM. 2009. Regulation of heterochromatin assembly on unpaired chromosomesduring Caenorhabditis elegans meiosis by components of a small RNA-mediated pathway. PLoS Genet 5: e1000624. PubMedID: 19714217Smardon A, Spoerke JM, Stacey SC, Klein ME, Mackin N, Maine EM. 2000. EGO-1 is related to RNA-directed RNApolymerase and functions in germ-line development and RNA interference in C. elegans. Curr Biol 10: 169-78. PubMed ID:10704412Smith HE, Fabritius AS, Jaramillo-Lambert A, Golden A. 2016. Mapping Challenging Mutations by Whole-GenomeSequencing. G3 (Bethesda) 6: 1297-304. PubMed ID: 26945029 11/30/2022 - Open Access Thivierge C, Makil N, Flamand M, Vasale JJ, Mello CC, Wohlschlegel J, Conte D Jr, Duchaine TF. 2011. Tudor domain ERI-5tethers an RNA-dependent RNA polymerase to DCR-1 to potentiate endo-RNAi. Nat Struct Mol Biol 19: 90-7. PubMed ID:22179787Funding: This research was supported in part by the Intramural Research Program of the NIH, The National Institute ofDiabetes and Digestive and Kidney Diseases (NIDDK) (H.S. and K.O.), and by NSF grant #IBN-9318709 (E.M.M.).Author Contributions: Samantha A. Stein: investigation. Olivia F. Zucaro: investigation. Harold E. Smith: investigation,methodology, writing - review editing. Kevin F. O'Connell: investigation, writing - review editing. Jill M. Spoerke:investigation. Eleanor M. Maine: investigation, conceptualization, funding acquisition, project, supervision, writing - reviewediting. James L. Lissemore: conceptualization, investigation, writing - original draft, project, supervision, visualization,writing - review editing, data curation.Reviewed By: AnonymousHistory: Received September 29, 2022 Revision Received October 19, 2022 Accepted November 28, 2022 PublishedOnline November 30, 2022 Indexed December 14, 2022Copyright: © 2022 by the authors. This is an open-access article distributed under the terms of the Creative CommonsAttribution 4.0 International (CC BY 4.0) License, which permits unrestricted use, distribution, and reproduction in anymedium, provided the original author and source are credited.Citation: Stein, SA; Zucaro, OF; Smith, HE; O'Connell, KF; Spoerke, JM; Maine, EM; Lissemore, JL (2022). om92, a glp-1enhancer mutation, is an allele of ekl-1. microPublication Biology. 10.17912/micropub.biology.000698 11/30/2022 - Open Access

om92, a glp-1 enhancer mutation, is an allele of ekl-1

Abstract

Similar works

Full text

Available Versions

John Carroll University

PubMed Central