AIMS: Molecular biology techniques based on the detection of genomic sequences by reverse transcription combined with polymerase chain reaction (PCR) have enabled the detection of different RNA viruses in serum or plasma samples. Since the dengue epidemic outbreak declared in Argentina in 2009, numerous patients´ samples were analyzed for the acute phase of infection. One of the main methodological drawbacks is the lack of internal control to measure the effectiveness of the viral extraction and reverse transcription process. In this article, we propose to standardize a molecular method to detect beta actin (â-Act) and glucose 6 phosphate dehydrogenase (G6PDH) complementary DNAs (cDNAs) present in patient´s plasma/serum, as a control process. RESULTS: RNA extraction, reverse transcription, and PCRs for human G6PDH, â-Act, and the dengue virus genome were performed. cDNA fragments for â-Act and G6PDH were amplified for all samples, regardless of the presence or absence of viral RNA. CONCLUSIONS: Amplification of â-Act and G6PDH cDNAs can be used as a control for the extraction and reverse transcription processes during dengue virus detection. This could also be a useful method for controlling the above steps when infections caused by other RNA viruses are studied, even if another methodology is employed, such as real-time PCR.Fil: Galván, Cristian Ariel. Universidad Católica de Córdoba. Facultad de Ciencias Químicas; ArgentinaFil: Elbarcha, Osvaldo C.. No especifíca;Fil: Fernández, Eduardo J.. No especifíca;Fil: Beltramo, Dante Miguel. Universidad Católica de Córdoba. Facultad de Ciencias Químicas; Argentina. Provincia de Córdoba. Ministerio de Ciencia y Técnica. Centro de Excelencia en Productos y Procesos de Córdoba; Argentina. Consejo Nacional de Investigaciones Científicas y Técnicas. Centro Científico Tecnológico Conicet - Córdoba; ArgentinaFil: Soria, Néstor Walter. Universidad Católica de Córdoba. Facultad de Ciencias Químicas; Argentin

Beltramo, Dante Miguel

Elbarcha, Osvaldo C.

Fernández, Eduardo J.

Galván, Cristian Ariel

Soria, Néstor Walter

Genetic Testing and Molecular Biomarkers

English

Cristian A. Galván

Osvaldo C. Elbarcha

Eduardo J. Fernández

Dante M. Beltramo

Néstor W. Soria

Crossref

Development of a Method to Control the RNA Extraction and Reverse Transcription Steps for the Detection of Dengue Virus Present in Human Blood Samples

LAReferencia - Red Federada de Repositorios Institucionales de Publicaciones Científicas Latinoamericanas

Development of a Method to Control the RNA Extractionand Reverse Transcription Steps for the Detectionof Dengue Virus Present in Human Blood SamplesCristian A. Galván,1,2 Osvaldo C. Elbarcha,1 Eduardo J. Fernández,1Dante M. Beltramo,2,3 and Néstor W. Soria1,2Aims: Molecular biology techniques based on the detection of genomic sequences by reverse transcriptioncombined with polymerase chain reaction (PCR) have enabled the detection of different RNA viruses in serum orplasma samples. Since the dengue epidemic outbreak declared in Argentina in 2009, numerous patients’ sampleswere analyzed for the acute phase of infection. One of the main methodological drawbacks is the lack of internalcontrol to measure the effectiveness of the viral extraction and reverse transcription process. In this article, wepropose to standardize a molecular method to detect beta actin (b-Act) and glucose 6 phosphate dehydrogenase(G6PDH) complementary DNAs (cDNAs) present in patient’s plasma/serum, as a control process. Results: RNAextraction, reverse transcription, and PCRs for human G6PDH, b-Act, and the dengue virus genome wereperformed. cDNA fragments for b-Act and G6PDH were amplified for all samples, regardless of the presence orabsence of viral RNA. Conclusions: Amplification of b-Act and G6PDH cDNAs can be used as a control for theextraction and reverse transcription processes during dengue virus detection. This could also be a useful methodfor controlling the above steps when infections caused by other RNA viruses are studied, even if anothermethodology is employed, such as real-time PCR.IntroductionSeveral human RNA viruses have been discovered in thelast years, the majority of them have been implicated asetiological agents of severe disease entities. Thus, there is aclear need for accurate identification of these human virusesin clinical laboratories. Dengue fever (DF) is a mosquito-bornedisease caused by four dengue virus serotypes (DEN 1 to 4) ofthe genus Flavivirus (Holmes and Twiddy, 2003; Thomaset al., 2003). Infection with one serotype provides lifelongimmunity to the infecting serotype only. People can acquire asecond serotype, and these secondary infections put them atgreater risk for dengue hemorrhagic fever (DHF), the mostsevere form of the disease (Rothman, 2004). The DHF ischaracterized by hemorrhagic manifestations, thrombocyto-penia, and increased vascular permeability, which can lead todeath. On the other hand, the worldwide resurgence of den-gue infection and clinical manifestation of this disease overthe past 25 years have been notable; generally, major epi-demics are associated with more severe forms of the disease(Holmes and Twiddy, 2003; Thomas et al., 2003; Gubler, 2004;Mackenzie et al., 2004; Edelman, 2005). The World HealthOrganization estimated in 2004 that there were between 50and 100 million cases of DF, 500,000 cases of DHF, and 20,000deaths as a result thereof, making dengue the arboviruscausing the most number of human cases (Mackenzie et al.,2004). The incidence of dengue infection has substantiallyincreased in the Americas because of the expansion of theurban mosquito vector, Aedes aegypti. In 2009, Argentina hadthe greatest epidemic of this disease, with around 30,000infected.For diagnosis, clinical laboratories use tissue culture forvirus isolation and serological methods to confirm the viralserotype (Shu and Huang, 2004). The reverse transcriptase–polymerase chain reaction (PCR) amplifies nucleic acid se-quences and has provided a fast, sensitive, early technique fordengue virus detection. One problem remains unresolved—the inability to have a method that ensures that the earlystages of viral RNA detection have been properly done. Thisproblem also occurs in the detection of other types of RNAviruses. Nevertheless, nucleic acids (DNA and RNA) arepresent in blood samples and used in fetal medicine, oncol-ogy, transplant, etc. (Holford et al., 2008). Based on thesefindings, our work aims to contribute with a method to ensure1Laboratorio de Análisis Clı́nicos Especializados (LACE), Córdoba, Argentina.2Cátedra de Biotecnologı́a, Facultad de Ciencias Quı́micas, Universidad Católica de Córdoba, Córdoba, Argentina.3Centro de Excelencia en Productos y Procesos de Córdoba (CEPROCOR), Santa Marı́a de Punilla, Córdoba, Argentina.GENETIC TESTING AND MOLECULAR BIOMARKERSVolume 15, Number 12, 2011ª Mary Ann Liebert, Inc.Pp. 913–915DOI: 10.1089/gtmb.2011.0091913that the entire processes of RNA extraction and reverse tran-scription have been correctly made, thus avoiding false-negative results due to errors during these steps.Materials and MethodsVirusSera pool from patients infected with dengue virus donatedby Dr. Sandra Gallego was used (Central Laboratory of theProvince of Córdoba, Córdoba, Argentina).Clinical samplesFreshly frozen plasma and/or serum samples were col-lected from patients at the LACE. The study was approved bythe Committee of Ethics and Research from the Oulton-Romagosa and Ministerio de Salud de Córdoba and is in ac-cordance with the Declaration of Helsinki. In all cases, thesubjects were informed and their consent was obtained.RNA extractionTotal RNA was extracted manually using a Viral Mini kitsystem (Qiagen, Inc.), following the manufacturer’s instruc-tions. RNA was eluted in 60 mL of nuclease-free water.Reverse transcriptionThe complementary DNA (cDNA) was synthesized usingSuperscript III (Invitrogen, Inc.). Briefly, a mixture containing6 mL of MilliQ water (DNase and RNase free), 300 ng of ran-dom primers, 5mL of viral RNA, and 0.5 mM of each of dGTP,dATP, dCTP, and dTTP was incubated at 65C for 5 min.Then, the mixture was left 1 min at 4C. This mix was com-bined with 4mL of 5 · First Strand Buffer, 5 mM DTT, 4 URNAse OUT, and 5 U Superscript III and incubated at 25C for5 min and 55C for 60 min. Finally, the enzyme was in-activated for 15 min at 70C.Design of oligonucleotides and PCRThe primer designs for b-Act and glucose 6 phosphatedehydrogenase (G6PDH) amplification were performedwith Primer-Blast software (www.ncbi.nlm.nih.gov/tools/primer-blast/), taking into account the position of thosegenes in the genome, to amplify and discriminate bothcDNA and genomic DNA. This was necessary because in theamplification process, genomic DNA contamination couldbe observed in the RNA extraction step. The oligonucleotidesequences are listed in Table 1, as the size of the fragmentsexpected. Oligonucleotides and PCR conditions for denguedetection were performed according to the procedure ofLanciotti et al. (1992).PCRs were carried out using an MJ Research thermal cycler.The reaction volume of 15 mL consisted of 1mL cDNA, 3 mL of5 · buffer, 200mM each of dGTP, dATP, dCTP, and dTTP,0.6 nM forward primer, 0.6 nM reverse primer; 0.6 U GoTaqpolymerase (Promega), and water qsp 15 mL. Amplificationconditions were 94C for 5 min, 35 cycles of 94C for 40 s, 59Cfor 40 s, and 72C for 75 s, and a final extension at 72C for7 min.The amplified fragments were separated by electrophoresisat 80 V for 30 min on a 1% agarose gel in TAE 1 · , previouslystained with ethidium bromide (10 mg/mL).ResultsRNA extractions and reverse transcriptions were per-formed using serum and/or plasma from patients suspectedto have dengue infection. Freshly frozen samples were ana-lyzed. Figure 1 shows the PCR products obtained for differentsamples amplified for G6PDH (A) and b-Act gene (B). Allplasma/serum samples gave positive amplification. In allcases wherein amplification is found, it corresponds to cDNAand not to DNA. This indicates that our method allowed us toTable 1. Primer Sequences and Polymerase Chain Reaction—Amplified Expected SizeFragments size (bp)Primers name Primers sequences (5¢/3¢) cDNA DNAb-Act forward ATGATATCGCCGCGCTCGTCGTC 289 423b-Act reverse TCGGGAGCCACACGCAGCTCATG6PDH forward CCGCATCGACCACTACCTGGGCAAG 342 1331G6PDH 0everse GTTCCCCACGTACTGGCCCAGGACCAFIG. 1. Results of the PCR assay for G6PDH (A) and b-Act(B) after separation in agarose gel by electrophoresis. Lanes 1and 10, a 100-bp DNA ladder; lane 2, negative control; lane 3,genomic DNA; lanes 4–6, three different cDNA from serumsamples; lanes 7–9, three different cDNA from plasma sam-ples. G6PDH, glucose 6 phosphate dehydrogenase; PCR,polymerase chain reaction; cDNA, complementary DNA.914 GALVÁN ET AL.know whether the RNA extraction and reverse transcriptionwere properly done, regardless of the presence or absence ofviral RNA (Fig. 2).DiscussionThe results obtained in this work show that PCR employed todetect G6PDH or b-Act cDNAs can be used to control RNAprocessing in the dengue virus detection in both human serum/plasma. Moreover, according to the design of oligonucleotide,we can easily know whether the amplified products correspondto cDNA or genomic DNA. This consideration is importantbecause, to the moment, there was no way to determine whe-ther the RNA extraction and reverse transcription processes hadbeen successful done. Without these controls, in some cases,samples reported negative for dengue virus could be wrongbecause of errors in the first steps of RNA extraction and reversetranscription processes. In short, the addition of either of thesecontrols can offer greater security to inform negative results.Moreover, this procedure can be also applied to retrovirusespresent in human specimens.AcknowledgmentsThe authors acknowledge the funding provided by theLACE laboratory and the Central Laboratory of the Provinceof Córdoba for providing positive control of dengue virus.Disclosure StatementThe authors declare that they have no conflict of interests.ReferencesEdelman R (2005) Dengue and dengue vaccines. J Infect Dis191:650–653.Gubler DJ (2004) The changing epidemiology of yellow feverand dengue, 1900–2003 full circle? Comp Immunol MicrobiolInfect Dis 27:319–330.Holford NC, Ramoutar A, Butt AN, et al. (2008) Normalizationof circulating nucleic acid results. Should we use b-actin? AnnNY Acad Sci 1137:112–118.Holmes EC, Twiddy SS (2003) The origin, emergence andevolutionary genetics of dengue virus. Infect Genet Evol3:19–28.Lanciotti RS, Calisher CH, Gubler DJ, et al. (1992) Rapid detec-tion and typing of dengue viruses from clinical samples byusing reverse transcriptase-polymerase chain reaction. J ClinMicrobiol 3:545–551.Mackenzie JS, Gubler DJ, Petersen LR (2004) Emergingflaviviruses: the spread and resurgence of Japanese en-cephalitis, West Nile and dengue viruses. Nat Med 12(Suppl):s98–s109.Rothman AL (2004) Dengue: defining protective versus patho-logic immunity. J Clin Invest 113:946–951.Shu PY, Huang JH (2004) Current advances in dengue diagnosis.Clin Diagn Lab Immunol 11:642–650.Thomas SJ, Strickman D, Vaughan DW (2003) Dengue epide-miology: virus epidemiology, ecology, and emergence. AdvVirus Res 61:235–289.Address correspondence to:Néstor W. Soria, Ph.D.Laboratorio de Análisis Clı́nicos Especializados (LACE)Avenida Vélez Sarsfield 562Córdoba 5000ArgentinaE-mail: nes_soria@yahoo.com.arDante M. Beltramo, Ph.D.Centro de Excelencia en Productos y Procesosde Córdoba (CEPROCOR)Santa Marı́a de PunillaCórdoba 5000ArgentinaE-mail: dbeltramo@yahoo.com.arFIG. 2. Results of the PCRassay for dengue virus;G6PDH and b-Act genomesafter separation in agarose gelby electrophoresis. (A) Blank;(B) positive plasma samplefor dengue virus; (C) negativeplasma sample for denguevirus.A METHOD TO CONTROL VIRAL RNA FOR DETECTION PROCESS 915

Development of a method to control the RNA extraction and reverse transcription steps for the detection of dengue virus present in human blood samples

CONICET Digital

https://ri.conicet.gov.ar/bitstream/11336/199904/2/CONICET_Digital_Nro.c07b2ae3-1b62-4003-b682-2a61e23d6158_B.pdf

Development of a method to control the RNA extraction and reverse transcription steps for the detection of dengue virus present in human blood samples

Abstract

Similar works

Full text

Available Versions

Crossref

LAReferencia - Red Federada de Repositorios Institucionales de Publicaciones Científicas Latinoamericanas

CONICET Digital