Carter, P.

Chard, T.

Iles, R.

Neven, P.

Shepherd, J.

English

Middlesex University Research Repository

Diurnal VarIatIon of Urinary “hCG $ Subunit CoreFragment” Production Evaluated in Patients wfthGynecological Neoplasms, Patrick Neven,”2 Ray KI/es,3 Paul G. Carter,’ John H. Shepherd,’ and TimChard3 [1 Gynecol. Once!. Unit, St. Bartholomew’s Hosp.and the Royal Marsden Hosp., London; 2AmeneKliniek St. Jan, Broekstraat 1000, Brussels, Belgium(address for correspondence), fax 32-2-219-86-96;3Wilhianison Lab. for Molec. Oncol., St. Bartholomew’sHosp., London]Urinary metabolites of the (3 subunit of human chorionicgonadotropin (hCG(3), particularly the fragment known as(3-core, are potential tumor markers for gynecological can-cers (1-6). We have found that an increased concentration(tg’L) of (3-core in early-morning urine samples is rela-tively common in gynecological cancers, but the sensitivity(36%) and specificity (90%) of such measurements are low(7). Most clinical studies have reported /3-core concentra-tions in early-morning or random urine specimens withoutcorrection for urine volume or concentration (1-7). Formany urinary solutes, however, including proteins, ex-pressing the concentration as a ratio to the urinary creat-inine concentration is less variable and may better reflectthe true urine output than does concentration per unitvolume (8-11).In the present study, we examined the variation of uri-nary (3-core excretion over a 24-h period, to determinewhether expressing (3-core results as a ratio to creatinine orto total volume of urine gave results that were less variablethan concentrations per unit volume for any given early-morning or random specimen.Urine samples were obtained preoperatively from 35women, ages 28-66 years. All were hospitalized for surgicaltreatment of a benign (n = 8) or malignant (n = 27) gyne-cological condition. The patients had serum creatinine con-centrations within the normal reference range, were instable condition, and were selected from an inpatient pop-ulation on the basis of their willingness to cooperate withthe study. The procedures followed were in accordance withthe ethical standards of our institution’s responsible com-mittee. The women collected a portion from each urinespecimen passed during 24 h; 20 of these women recordedboth the volume and the time of each micturition. Sodiumaside (1 g/L) was added to the unprocessed urine, which wasstored at -20#{176}Cuntil analysis.Results on 16 women were excluded: 11 because of failureto conform to the collection protocol and 5 because there wasno measurable (3core in an early-morning urine specimen.For the 24-h analysis, a complete set of samples was obtainedin 19 women (136 specimens, an average of 7 per subject).We measured /3-core by RIA (detection limit 0.1 tg’L) asdescribed previously (12). In this assay, (3-core shows partialcross-reactivity with intact hCG (6.9%) and free hCG(3 (18%)and negligible cross-reactivity for luteinizing, thyroid-stim-ulating, and follicle-stimulating hormones (<0.7%). Creati-nine was measured by a kinetic Jaff#{233}method with a Hitachi717 analyzer. The specimens from each woman were thawedand analyzed in a single assay. One analyst performed allthe assays, and the same batches of reagents were used484 CLINICAL CHEMISTRY, Vol. 40, No. 3, 1994throughout. The between-assay variability (CV) rangedfrom 2.3% to 13.4% for /3-core (0.1 to 5 j.tg/L) and from 2.5%to 2.7% for urine creatinine (3.9 to 7.1 mmoJJL). The within-assay variability ranged from 2% to 12.5% for (3-core andfrom 1.1% to 1.5% for creatunine.The concentration of /3-core was expressed as either pg/L,mg/mol of creatinine, or &g/h. The CVs for the three indiceswere compared by using one-way analysis of variance.Variations with time (CVs) in individual women rangedfrom 14.9% to 103% (mean 45.2%) for /3-core concentration,from 7.4% to 43.6% (mean 19.1%) for /3-core per mole ofcreatinine, and from 9.6% to 42.6% (mean 2 1.9%) for (3-coreper unit of time. The CV for concentration Q.tg’L) wassignificantly greater than the CVs for (3-core expressed perunit of creatinine or time (P <0.01). There was no evidencefor any systematic early-morning peak or time-related pat-tern in any of the three indices, although six subjects hadtheir highest /3-core concentration (zgJL) in the early-morning specimen. Four women had no measurable /3-corein the whole 24-h collection. Urine (3-core and creatinineconcentrations were closely related; for all patients, thecoefficient of linear correlation (r) ranged from 0.732 to0.997. In five cancer patients, from whom at least six mea-surements of urinary (3-core exceeded the RIA detectionlimit, we found a modest to strong correlation with creati-nine content (r = 0.666 to 0.985) and a significant fit to alinear regression model (P = 0.07 to <0.0001). However,when all data were combined, the correlation decreased (r= 0.402) because of the variable output of /3-core from eachindividual patient. Hourly /3-core excretion and (3-core perunit creatinine in early-morning samples were also related(r = 0.756).The advantages of reporting concentrations of substancesexcreted in urine after adjustment for urine concentrationhas been shown for several different solutes (8-11). Otherurine tumor markers, e.g., tumor-associated antigen, showa systematic diurnal excretion pattern (13). In this studywe were not able to identify a systematic diurnal rhythm inurine /3-core production in women with gynecological neo-plasia, similar to observations made during the first tri-mester of pregnancy (14).Paterson (15) noted that creatinine output is not suffi-ciently constant to act as a reference against which theexcretion of other solutes can be standardized, and sug-gested that the time-related excretion rate of a soluteshould be more reliable than this. By contrast, the presentdata show that time-to-time variation is equally reduced byexpressing results per unit of creatinine or per unit of time.However, we recognize that adjustment for urinary creat-mine within an individual does not allow for systematicdifferences in creatimne excretion between individuals,e.g., because of differences in lean body mass.The clinical importance of the present findings is thatmeasurement of (3-core in a single early-morning or ran-dom urine specimen is likely to give a more accurate resultwhen the value is related to creatunine concentration.Whether this index will better distinguish between thebenign and malignant group and whether creatunine-cor-rected /3-core is a better prognostic indicator are the sub-jects of on-going studies.CLINICAL CHEMISTRY, Vol. 40, No. 3, 1994 485This study was supported by a Belgisch Werk Tegen KankerResearch Fellowship and The Frances and Augustus NewmanFoundation and by a grant from The Cancer Research Campaignof Saint Bartholomew’s Hospital.References1. Cole LA, Schwartz PE, Wang Y. Urinary gonadotropin frag-ments (UGF) in cancers of the female reproductive system. I.Sensitivity and specificity, comparison with other markers. Gyne-col Oncol 1988;31:82-90.2. O’Connor JF, Schiatterer JP, Birken 5, Krichevsky A, Arm-strong EG, McMahon D, et al. Development of highly sensitiveimmunoassays to measure human chorionic gonadotropin, itsp-subunit and p-core fragment in the urine: application to malig-nancies. Cancer Res 1988;48:1361-6.3. Nam JH, Cole LA, Chambers JT, Schwartz PE. Urinary gonad-otropin fragment, a new tumor marker. I. Assay development andcancer specificity. Gynecol Oncol 1990;36:383-90.4. Cole LA, Nam JH, Chambers JT, Schwartz PE. Urine gonado-tropin fragment, a new tumor marker. II. Differentiating a benignfrom a malignant pelvic mass. Gynecol Oncol 1990;36:391-4.5. Nam JH, Chang KC, Chambers JT, Schwartz PE, Cole LA.Urinary gunadotropin fragment, a new tumor marker. III. Use incervical and vulvar cancers. Gynecol Oncol 1990;38:66-70.6. Kinugasa M, Nishimura R, Hasegawa K, Okamura M, KimuraA, Ohtsu F, Tacheuchi K. Assessment of urinary p-core fragmentof hCG as a tumor marker of cervical cancer. Nippon SankaFujinka Gakkai Zasshi 1992;44:188-94.7. Neven P, Iles RK, Shepherd JH, Hudson eN, Chard T. Urinarychorionic gonadotrophin subunits and /3-core in non-pregnantfemales. A case-control study of benign and malignant gynaeco-logical disorders. Cancer 1993;71:4124-30.8 Tuchnian M, Robison LL, Maynard RC, Ramnaraine ML,Krivit W. Assessment of the diurnal variations in urinary homo-vanillic and vanillylmandelic acid excretion for the diagnosis andfollow-up of patients with neuroblastoma. Clin Biochem 1985;18:176-9.9. Thompson SG, Barlow RD, Wald NJ, Van Vunakis H. Howshould urinary cotinine concentrations be adjusted for urinarycreatinine concentration? Clin Chim Acta 1990;187:289-96.10. Yoshimoto M, Tsiikahara H, Saito M, Hayashi 5, Haruki S,Fujisawa S, Sudo M. Evaluation of variability of proteinuriaindices. Pediatr Nephrol 1990;4:136-9.11. Lafolie P, Beck 0, Blennow G, Boreus L, Borg S, Elwin CE, etal. Importance of creatinine analyses of urine when screening forabused drugs. Cliii Chem 1991;37:1927-31.12. Lee CL, lies RK, Shepherd JH, Hudson CN, Chard T. Thepurification and development of a radioimmunoassay for p-corefragment of human choriomc gonadotrophin in urine; applicationas a marker of gynaecological cancer in premenopausal andpostmenopausal women. J Endocrinol 1991;130:481-9.13. Kopald KH, Gupta RK, Bauer RI, Morton DL. Diurnal vari-ation in the excretion of a tumour associated antigen into the urineof cancer patients [Abstract]. Proc Annu Meet Am Assoc CancerRes 1990;31A1544.14. Kent A, Kitau MJ, Chard T. Absence of diurnal variation inurinary chorionic gonadotrophin excretion at 8-13 weeks gesta-tion. Br J Obstet Gynaecol 1991;98:1180-1.15. Paterson N. Relative constancy of 24-hour urine volume and24-hour creatinine output. Clin Chim Acta 1967;18:57-8.Rapid ScreenIng for p53 Mutations wIth a SensittveHeteroduplex Detection Technique, Gregory J.Tsongalis, William K Kaufmann, Sandra J. Wilson,Kenneth J. Friedman, and Lawrence M. Silverman1(Dept. of Hospital Labs. and Pathol., Univ. of NorthCarolina, Chapel Hill, NC 27514; 1 author forcorrespondence: fax 919-966-4526)Genetic changes such as point mutations, rearrange-ments, and amplification or deletion in a single cell mayresult in malignant transformation. It is widely acceptedthat mutations in the p53 tumor suppressor gene areamong the most frequent alterations that occur during themalignant progression of many tumor types (1, 2). Theproduct of p53 is a 393-amino acid nuclear phosphoproteinthat was first described in 1979. Most mutations in p53occur in exons 5 through 8 in four evolutionarily conserveddomains (1). Mutations have been shown to cluster to theseconserved regions of p53 in many human tumors, includingbreast, colon, lung, brain, and leukemia/lymphoma.Li-Fraumeni syndrome (LFS) is a rare condition in whichaffected family members develop many different types oftumors similar to those sporadic tumor types that containp53 mutations (3). Germlinep53 mutations were first de-scribed in LFS patients who developed breast carcinomas,sarcomas, and brain tumors.We examined the ability of a heteroduplex technique todetect single-base mutations in cells from two previouslycharacterized LFS patients.Two human fibroblast cell lines, MDAHO41 andMDAHO87, derived from two LFS patients were obtainedfrom Michael Taunsky (University of Texas-MD AndersonCancer Center, Houston, TX) (4). MDAHO41 contained asingle-base deletion at codon 184 (exon 5), and MDAHO87,a point mutation at codon 248 (exon 7). The cells weregrown as previously described (5).We resuspended a cell pellet containing 1 x 10-2 x iOfibroblasts in 200 L of extraction buffer (50 mmol/L Tris-HC1, pH 7.6; 100 mmol/L NaCI; 1 mmol/L EDTA 5 g/Lsodium dodecyl sulfate) and digested it overnight with 290mg/L proteinase K at 37#{176}C.The samples were then incu-bated for 10 mm at 65#{176}Cto inactivate the proteinase beforebeing exposed to RNAse A for 1 h at 37#{176}C.DNA wasethanol-precipitated after the addition of saturated NaC1and resuspended in 10 mmol/L Tris-1 mmol/L EDTA, pH7.6.We incubated genomic DNA (0.5-1.0 jig), isolated asdescribed above, in a total reaction volume of 100 jiL con-taining 300 ng of both the forward and reverse exon-specificprimers, 2.5 U of Taq polymerase, 200 nmo]/L each deoxy-nucleotide triphosphate, 1.0 mmol/L MgC12, 67 mmol/LTris-HC1 (pH 8.8), 10 mmol/L 2-mercaptoethanol, 16.6mmol/L ammonium sulfate, and 6.7 jimol/L EDTA. Theprimers used were as follows: exon 5, 5’G11CACTI’GTGC-CCTGACTF3’ and 5’AGGAATCAGAGGCCTGGGGA3’;exon 7, 5’TGCVFGCCACAGGTCTCC3’ and 5’AACCAC-CCrFGTCCTTFCTG3’. DNA was initially denatured at94#{176}Cfor 6 min before amplification. Polymerase chain re-action (PCR) amplification was accomplished with 35 cyclesconsisting of 2 miii annealing at 55#{176}C,3 mm extension at72#{176}C,and 1 mm denaturation at 94#{176}C.The final cycleincluded a 2-mm annealing step at 55#{176}Cand a 10-mmextension step at 72#{176}C.The PCR-amplifled product from each patient was heat-denatured at 100#{176}Cin a beaker of water for 3 mm and thenslowly cooled to 45#{176}Cby allowing the sample to remain inthe water at room temperature on the benchtop. We mixedan aliquot of 40 jiL of this product with 6 jiL of gel loadingbuffer and electrophoresed the product on a 38-cm verticalHydrolink-MDE gel (AT Biochem, Malvern, PA) that was1.5 mm thick. We diluted the MDE gel to aix concentra-tion (from 2x stock) in 0.6x Tris-boric aeid-EDTA (TBE)buffer (lx = 133 mmol/L Tris, 81 mmol/L boric acid, and 3mmol/L EDTA) and 150 g/L urea. After gel polymerization,electrophoresis was carried out for 16 h at 500 V. The gel

Diurnal variation of urinary "hCG beta subunit core fragment" production evaluated in patients with gynecological neoplasms

https://repository.mdx.ac.uk/download/0098a87710a4a4b08e5bc69f4c95f17291311ef4e80e14009aeff967029f66b8/537623/Iles_-_Diurmal_variation_of_urinary....pdf

Diurnal variation of urinary "hCG beta subunit core fragment" production evaluated in patients with gynecological neoplasms

Abstract

Similar works

Full text

Available Versions

Middlesex University Research Repository