Bildt, MWG

Fitzjohn, TR

Kuiken, Thijs

Lema, S

Osterhaus, Ab

Visee, AM

English

EUR Research Repository

Emerging Infectious Diseases  •  Vol. 8, No. 2, February 2002 211DISPATCHESDistemperOutbreak and ItsEffect on AfricanWild DogConservationMarco W.G. van de Bildt,*† Thijs Kuiken,*† Aart M. Visee,‡ Sangito Lema,§ Tony R. Fitzjohn,§ and Albert D.M.E. Osterhaus*†In December 2000, an infectious disease spread through acaptive breeding group of African wild dogs (Lycaon pictus) inTanzania, killing 49 of 52 animals within 2 months. The caus-ative agent was identified as Canine distemper virus (CDV) bymeans of histologic examination, virus isolation, reverse tran-scriptase-polymerase chain reaction analysis, and nucleotidesequencing. This report emphasizes the importance of ade-quate protection against infectious diseases for the successfuloutcome of captive breeding programs of endangered species.he African wild dog (Lycaon pictus) is a highly endan-gered carnivore found in Africa south of the Sahara. Itspopulation, estimated at <5,500, has declined dramatically inrecent decades. Suggested causes for this decline include habi-tat loss, killing by humans, reduced prey availability, competi-tion with other carnivores, and infectious diseases, includingrabies and canine distemper (1).As part of a conservation plan for the African wild dog, acaptive breeding program was established in 1995 at MkomaziGame Reserve, Tanzania, under the auspices of the Govern-ment of Tanzania. A founder group of 25 animals was dividedinto four breeding packs, each housed in a separate fencedenclosure. The founder members and captive-born pups werevaccinated against canine distemper with a vaccine success-fully used in seals (2), rabies (Rabdomun, Schering-PloughAnimal Health, Brussels, Belgium), and parvoviral disease andleptospirosis (combination vaccine: Dohyvac I-LP, SolvayDuphar, Weesp, the Netherlands). The vaccination scheduleconsisted of three consecutive vaccinations at 2- to 4-weekintervals and annual revaccination, most recently in November1999. Blood samples from a proportion of the vaccinated ani-mals were collected at the time of vaccination to monitorimmune response. The OutbreakOn December 20, 2000, two of the African wild dogs inone of the breeding packs became ill from an apparently infec-tious disease. The disease spread rapidly and was first noted inthe other breeding packs on January 16, 18, and 22, 2001,respectively. The first deaths occurred on December 21, 2000;deaths peaked from January 30 to February 6, 2001, when 15of the wild dogs died. The last death was recorded on February13, 2001. Forty-nine of the 52 animals died during this out-break.Neutralizing antibody levels to Canine distemper virus(CDV), determined by methods similar to those used in astudy of large felids (3), were measured in serum samples col-lected from nine African wild dogs on November 8, 2000. Oneof the three animals that survived the outbreak had a neutraliz-ing antibody titer of 20; the other two were not tested. The serafrom the remaining eight animals had a titer of <20, which isconsidered to be below the level of protection against caninedistemper (4).Tissue samples from nine animals that had died were usedfor histologic examination (n=6), virus isolation (n=2), andreverse transcriptase-polymerase chain reaction (RT-PCR)with Morbillivirus-specific primers P1: 5'ATGTTTATGATCA-CAGCGGT 3' and P2: 5'ATTGGGTTGCACCACTTGTC 3',which have been used before for phylogenetic analysis of mor-billiviruses (5) (n=3). The results of analysis were consistentfor all animals tested. The main histologic lesion was broncho-interstitial pneumonia with epithelial necrosis and multinucle-ated syncytial cells. Eosinophilic intracytoplasmic inclusionbodies, characteristic of canine distemper, were found in theepithelium of lung, kidney, intestine, and urinary bladder (Fig-ure 1). Lung samples scored positive by RT-PCR for a Mor-billivirus P-gene fragment. Phylogenetic analysis of thenucleotide sequences from the resulting PCR fragments dem-onstrated that the causative virus was most closely related toCDV (Figure 2A) and clustered with the sequences of CDVstrains from domestic dogs (Canis familiaris), lions (Pantheraleo), and bat-eared foxes (Otocyon megalotis) from EastAfrica in the 1990s (Figure 2B). P-gene fragments of the virusisolates from lung samples were identical to the sequences ofthe PCR products obtained directly from the tissue samples. ConclusionsThese results show that the primary cause of death of theseAfrican wild dogs was CDV infection. Canine distemper ishighly infectious for many species of carnivores and causeshigh death rates in immunologically naïve populations (7). It isa known cause of death in free-living African wild dogs (8), aswell as other wild carnivores, both free-living and captive(9,10). Based on phylogenetic analysis, the causative viruswas a CDV strain circulating in the region in the past decade(11,12) (Figure 2B). Potential routes of transmission of this virus to the captivebreeding groups are by direct contact with infected domesticdogs or wild carnivores or indirectly by contact with humans*Seal Rehabilitation and Research Centre, Pieterburen, the Nether-lands; †Institute of Virology, Erasmus University Rotterdam, Rotterdam,the Netherlands; ‡The African Wild Dog Foundation, Schiedam, theNetherlands; and §Wildlife Preservation Trust Fund, KilimanjaroRegion, TanzaniaTDISPATCHES212 Emerging Infectious Diseases  •  Vol. 8, No. 2, February 2002or their equipment. Domestic dog populations in some parts ofTanzania are endemically infected with CDV and were consid-ered to be the source of infection for canine distemper inSerengeti lions in 1994 (13). Domestic dogs were not presentat Mkomazi Game Reserve; however, transmission of CDVfrom domestic dogs in neighboring villages cannot be ruledout.Because vaccination with live attenuated virus had beensuspected of causing past deaths of African wild dogs (14,15)the animals in this breeding program were vaccinated with aCDV-ISCOM vaccine, which does not contain live virus. Thisvaccine protects harbor seals (Phoca vitulina) and dogs againstphocine distemper virus infection (2), which is closely relatedto CDV, and resulted in protective antibody levels to CDV inAfrican wild dogs monitored at the beginning of this captivebreeding program (data not shown). However, the lack of neu-tralizing antibody titers to CDV in sera of these African wilddogs from November 2000 and the high death rate from caninedistemper despite recent vaccination indicate vaccination fail-ure. We are investigating possible reasons for this failure,including problems with application, maintenance of the coldchain, efficacy of the vaccine, and antiviral immune responseof the African wild dogs.Conservation of endangered species, both free-living andcaptive, has been jeopardized by infectious disease outbreaksin the past (10). This outbreak of canine distemper illustratesthe disastrous effects that such a disease can have on inade-quately protected animals. We therefore conclude that any fur-ther attempts to breed African wild dogs in captivity will needto ensure a vaccination regime against canine distemper andother infectious diseases that is both effective in this speciesand practical to implement under field conditions.AcknowledgmentWe thank the Ministry of Natural Resources and Tourism and theDepartment of Wildlife of Tanzania for their help and support.Figure 1. Lung lesions in an African wild dog with canine distemper.Hematoxylin and eosin staining. A. Bronchiole occluded by inflamma-tory cells and cell debris. B. Detail of A, showing multiple eosinophilicintracytoplasmic viral inclusions (arrows) in bronchiolar epithelium.Figure 2. Phylogenetic trees based on a 388-bp Morbillivirus P-genefragment. Maximum likelihood trees were generated by using the SEQ-BOOT and DNAML program of PHYLIP (Phylogeny Inference Package[6]) with 1,000 bootstrap replications. When possible, GenBank num-bers of the sequences are given in parentheses. A. Virus from Africanwild dogs and representative Morbillivirus members. MV = Measlesvirus (Edmonston): strain (M89920); RPV = Rinderpest virus: RBOKstrain (X68311); DMV = dolphin morbillivirus (Z47758); PMV = porpoisemorbillivirus (5); PDV = Phocine distemper virus-1 (X75960); CDV-O =Canine distemper virus (CDV): Onderstepoort strain (AF305419); andLP/Tan/01 = CDV African wild dog, Tanzania (this study). B. Virus fromAfrican wild dogs and several CDV strains. CDV-O = CDV: Onderste-poort strain (AF305419); Dog/Ger/90 = CDV from dog, Germany(AF259549); Rac/USA/92 = CDV from raccoon, USA (3); Dog/Jap/99 =CDV from dog, Hamamatsu strain, Japan (AB028915); Dog/Tan/94 =CDV from dog, Tanzania (U53715); Fox/Tan/94 = CDV from bat-earedfox, Tanzania (U53714); Lion/Tan/94 = CDV from lion, Tanzania(U53712); and LP/Tan/01 = CDV from African wild dog, Tanzania (thisstudy).Emerging Infectious Diseases  •  Vol. 8, No. 2, February 2002 213DISPATCHESMarco van de Bildt is a doctoral student at the Institute of Virol-ogy, Erasmus University Rotterdam, the Netherlands. His work isfocused on morbilliviruses in wildlife and, more specifically, inmarine mammals.References   1. Woodroffe R, Ginsberg JR, MacDonald DWR, and The IUCN/SSC CanidSpecialist Group. The African wild dog: Status survey and conservationaction plan. Gland, Switzerland: IUCN Publications; 1997.  2. Osterhaus ADME, UytdeHaag FGCM, Visser IKG, Vedder EJ, ReijndersPJ, Kuiper J, et al. Seal vaccination success. Nature 1989;337:21.  3. Harder TC, Kenter M, Vos H, Siebelink K, Huisman W, van AmerongenG, et al. Canine distemper virus from diseased large felids: biologicalproperties and phylogenetic relationships. J Gen Virol 1996;77:397-405.  4. Appel MJG, Gillespie JH. Canine distemper virus. In: Gard S, Hallauer C,Meyer KF, editors. Virology monographs, Vol. 11. Vienna-New York:Springer-Verlag; 1972. p. 3-96.  5. Barrett T, Visser IKG, Mamaev L, Goatley L, Van Bressem MF, Oster-haus ADME. Dolphin and porpoise morbilliviruses are genetically dis-tinct from Phocine distemper virus. Virology 1993;193:1010-2.  6. Felsenstein J. Phylogeny Inference Package. Version 3.75c. Seattle: Uni-versity of Washington Department of Genetics; 1993.  7. Appel MJ. Canine distemper virus. In: Appel M, editor. Virus infectionsof carnivores. Amsterdam; Elsevier Science Publishers BV: 1987. p. 133-59.  8. Alexander KA, Kat PW, Munson LA, Kalake A, Appel MJG. Canine dis-temper related mortality among wild dog (Lycaon pictus) in ChobeNational Park Botswana. J Zoo Wildl Med 1996;27:426-7.  9. Harvell CD, Kim K, Burkholder JM, Colwell RR, Epstein PR, GrimesDJ, et al. Emerging marine diseases—climate links and anthropogenicfactors. Science 1999;285:1505-10.10. Daszak P, Cunningham AA, Hyatt AD. Emerging infectious diseases ofwildlife—threats to biodiversity and human health. Science2000;287:443-9.11. Harder TC, Kenter M, Appel MJ, Roelke-Parker ME, Barrett T, Oster-haus ADME. Phylogenetic evidence of canine distemper virus inSerengeti's lions. Vaccine 1995;13:521-3.12. Roelke-Parker ME, Munson L, Packer C, Kock R, Cleaveland S, Carpen-ter M, et al. A canine distemper virus epidemic in Serengeti lions (Pan-thera leo). Nature 1996;379:441-5.13. Cleaveland S, Appel MG, Chalmers WS, Chillingworth C, Kaare M, DyeC. Serological and demographic evidence for domestic dogs as a sourceof canine distemper virus infection for Serengeti wildlife. Vet Microbiol2000;72:217-27.14. Van Heerden J, Bainbridge N, Burroughs RE, Kriek NP. Distemper-likedisease and encephalitozoonosis in wild dogs (Lycaon pictus). J Wildl Dis1989;25:70-5.15. Durchfeld B, Baumgartner W, Herbst W, Brahm R. Vaccine-associatedcanine distemper infection in a litter of African hunting dogs (Lycaon pic-tus). Zentralbl Veterinarmed 1990;37:203-12.Address for correspondence: A.D.M.E. Osterhaus, Institute of Virology, Eras-mus University Rotterdam, P.O. Box 1738, 3000 DR Rotterdam, The Nether-lands; fax: +31 10 408 9485; e-mail: osterhaus@viro.fgg.eur.nlGuidelines for Dispatches. These brief articles are updateson infectious disease trends and research. The articlesinclude descriptions of new methods for detecting, charac-terizing, or subtyping new or reemerging pathogens.Developments in antimicrobial drugs, vaccines, or infec-tious disease prevention or elimination programs are appro-priate. Case reports are also welcome. Dispatches (1,000 to1,500 words) need not be divided into sections. Provide ashort abstract (50 words); references, not to exceed 10; fig-ures or illustrations, not to exceed two; and a brief bio-graphical sketch.

Distemper outbreak and its effect on African wild dog conservation

https://pure.eur.nl/files/46640154/11897078.pdf

Distemper outbreak and its effect on African wild dog conservation

Abstract

Similar works

Full text

Available Versions

EUR Research Repository