Armbruster, G.

Baur, B.

Koller, B.

RERO DOC Digital Library

Foot mucus and periostracum fraction as non-destructive source of DNAin the land snail Arianta arbustorum, and the development of newmicrosatellite lociG.F.J. Armbruster1,*, B. Koller2 & B. Baur11Department of Integrative Biology, Section of Conservation Biology, University of Basel, St Johanns-Vorstadt 10, CH-4056 Basel;2ECOGENICS GmbH, Wagistrasse 23, CH-8952 Schlieren, Switzerland (*Corresponding author: Phone:0041 61 2670857; Fax: 0041 61 2670832; E-mail: g.armbruster@unibas.ch)Received 15 June 2004; accepted 26 July 2004Key words: DNA isolation, ﬁngerprinting, gastropods, non-invasive geneticsFeathers, hair, egg membranes, bones, urine andfaeces have all been utilized as non-invasive sour-ces of DNA in vertebrate studies (e.g., Taberletand Luikart 1999; Alpers et al. 2003; Idaghdouret al. 2003; Wisely et al. 2004; Hedmark et al.2004). In insects, exuviae and caterpillar frass canserve as non-destructive DNA source (Feinstein2004). Similar non-invasive sources of DNA arenot yet available for endangered and rare mol-luscs. In this note, we report on two novel, non-destructive methods of DNA isolation in the landsnail Arianta arbustorum (L.), and present ninenovel microsatellite loci since previously publishedloci yielded a complete lack of heterozygosity(Locher and Baur 2001).A conspicuous property of the gastropod integ-ument is its facility to produce abundant amountsof mucus and proteineous ﬂuid (Luchtel andDeyrup-Olsen 2001). Mucus is essential for loco-motion. Copious mucus secretion can also deterattacks of invertebrate predators. We collectedmucus samples by smoothly rubbing a 1-ml plastictip on the foot of living A. arbustorum. In order toincrease yield of genomic DNA, foot rubbing wasrepeated after 10 min using a second 1-ml plastictip. Both tips were put together, and were incubatedfor 10 min at 70 C in 200 ml of ATL buﬀer(DNeasy Tissue Kit, Cat. No. 69506; QIAGEN2003) followed by a proteinase K digestion at 55 Cand buﬀer and spin column treatment (QIAGEN2003). Nucleic acids were eluted using 80 ml AEbuﬀer (QIAGEN 2003). DNA obtained from mu-cus samples was compared withDNA isolated from20 to 30 mg foot tissue of the same individuals(following theDNeasy protocol of QIAGEN2003).The shell of terrestrial snails has two distinctlayers: the thick, inner ostracum made mostly ofcalcium carbonate, and the outer periostracum,which is proteinaceous, horny and transparent.Growing juveniles build ﬁrst the organic periostra-cum and then deposit the ostracum. Damages tothe newly built, soft periostracum can be repairedwithin 2–3 weeks. We removed a piece (ca. 0.5 cm2)of the newly built, uncalciﬁed periostracum ofimmature A. arbustorum. The samples were trans-ferred in 200 ll ATL buﬀer and nucleic acids wereisolated as described above for the mucus samples.The immature snails did not suﬀer from this treat-ment. They rebuilt the removed part of the perios-tracum and continued shell growth as did untreatedcontrol snails. After attaining adult size, the indi-viduals were frozen for DNA extraction from foottissue.An enriched genomic library was constructedby ECOGENICS GmbH (Zurich, Switzerland),with size-selected genomic DNA, ligation intoTSPAD-linker (Tenzer et al. 1999), and magneticbead selection of biotin-labeled (CA)13 motifsConservation Genetics (2005) 6:313–316  Springer 2005DOI 10.1007/s10592-004-7823-9Table1.NinenovelmicrosatellitelocifromAriantaarbustorumLocusRepeatmotifbasedonsequencedclonePrimersequence(5¢–3¢)Ta(C)No.ofallelesSize(bp)nH0HERunningtimeAccessionno.A9(GT) 9F:CCCATATCTGCCTGTCTTTC586160–192190.60*0.784hAY365435R:GGGATATCAATGTATGGGTTCGH9(GT) 11F:TTCTGTATCAGGTTAGCCTGTTTG634141–153200.45*0.703hAY365436R:CTATGTCGGTCATCATCGGACTGC3(CA) 22AT(AC) 8ATAF:GGCATATATAGGTTCTTCTTGCGTATG6311132–244200.800.822h20¢AY365437(CA) 7T(AC) 7T(AC) 15R:TGCCATGGTGTCAAACTGTCH8(AC) 9(N) 45(CA) 8(N) 3F:TTCGTTCATTCGTTCGTTCC628222–248200.650.777hAY365438(AC) 8(N) 11(AC) 11R:GTCGTTGGCATCAACTGC24(AC) 20F:CTTCCCTCTCTCTTTATCCGAAC588100–122200.40**0.771h30¢AY365439R:GATTCGAACCCAGGATCACC13(CA) 17(N) 18(CA) 12(N) 14F:TGGACGGACGCAGAAGAATC587130–152140.15**0.522h15¢AY365440(AC) 11R:GATCGGGTTCCAGTAAAGC26(AC) 8ATA(AC) 6F:CAGAACTGTCCAGACTGTATTCG637130–162200.50*0.802h15¢AY365441R:GTTGGCATTTTGTTTTGCAC55(AC) 22F:GACATTTCGTTTGGACACAATC567166–214200.650.764hAY365442R:CCTCCTTGGAATAGGTAACTAGG42(AC) 13F:ATAGTTTACTGCCACGCCTGCT637139–193140.10**0.522h20¢AY365443R:TTCACCTGTATGGCGTTGTTAGF,forwardprimer;R,reverseprimer;Ta,optimalannealingtemperature;n,numberofgenotypedindividuals;H0,observedheterozygosity(probabilitytestforlackheterozygosity:*P<0.05,**P<0.001);HE,expectedheterozygosity.RunningtimeofelectrophoresisisshownforSpreadexEL-400gelsataconstanttemperatureof55C.314(Gautschi et al. 2000a,b). Of 672 recombinantcolonies, 174 gave positive signals after hybrid-ization. Plasmids from 72 positive clones weresequenced and primers were developed for 22microsatellite inserts. Primers were tested in indi-viduals from Gurnigelbad, Switzerland (n ¼ 19)and Tallinn, Northern Estonia (n ¼ 1) usingstandard DNA extraction of frozen foot tissue(QIAGEN 2003). PCR mixture was 10–20 ng ofDNA (2 ll), 0.5 lM of each forward and reverseprimer, 1.5 mM MgCl2 and 2 ll of 10x PCRbuﬀer, adjusted with ddH20 to 20 ll. PCR was30–35 cycles, with 95 C for 30 sec, locus speciﬁcannealing for 30 sec (Table 1), and 72 C for30 sec. PCR was ﬁnished with an extension of8 min at 72 C. Spreadex EL-400 gels (ElchromScientiﬁc AG, Switzerland) were used. Horizontalelectrophoresis was performed with SEA 2000TMadvanced submerged gel electrophoresis equip-ment (Elchrom Scientiﬁc AG). All primer pairsgave excellent results, with very few or no stutterbands. A total of 65 alleles were found (Table 1).Of these, eight alleles were exclusively detected inthe specimen of Estonia, suggesting geographicdiﬀerentiation. Six of the tested loci showed adeviation from Hardy–Weinberg equilibrium thatcould be either the result of null alleles or sam-pling artifacts (Table 1). Moreover, in pairwisecomparison the loci ‘‘C3’’ and ‘‘42’’ showed atrend (P < 0.06) for linkage disequilibrium (testedwith GENEPOP version 3.1d, see Raymond andRousset 1995).All three DNA sources yielded identicalallelic patterns (Figure 1). In the comparison ofthe DNA from the three sources, each 5 ll AEvolume of the mucus and periostracum sampleswere used for PCR, whilst 10–20 ng DNA(solved in 5 ll ddH2O) isolated from the foottissue was required (see above). However,genotyping errors should be checked beforepopulation studies are conducted, because allelicdropouts may occur in non-invasive samples(e.g., Taberlet and Luikart 1999; Parsons 2001;Sefc et al. 2003). The extraction volume of thetwo foot rubbing samples (80 ll) is suﬃcient toscreen 16 loci (or eight loci twice, or four locithree times; depending on error risk). The amountof DNA from mucus was increased by repeatingfoot rubbing of the focal snail. The use of thesenovel sources of DNA need not be limited toA. arbustorum. The non-destructive methods areparticularly suitable for endangered and rareterrestrial gastropods and may ﬁnd widerapplicability.AcknowledgementFinancial support was received from the SwissNational Science Foundation.ReferencesAlpers DL, Taylor AC, Sunnucks P, Bellman SA, Sherwin WB(2003) Pooling hair samples to increase DNA yield for PCR.Conserv. Genet., 4, 779–788.Feinstein J (2004) DNA sequence from butterﬂy frass andexuviae. Conserv. Genet., 5, 103–104.Gautschi B, Tenzer I, Mu¨ller JP, Schmid B (2000a) Isolationand characterisation of microsatellites in the bearded vulture(Gypaetus barbatus) and cross ampliﬁcation in three OldWorld vulture species. Mol. Ecol., 9, 2193–2195.Gautschi B, Widmer A, Koella J (2000b) Isolation and char-acterization of microsatellite loci in the dice snake (Natrixtessellata). Mol. Ecol., 9, 2191–2193.Figure 1. Electrophoretic patterns of locus ‘‘26’’ and ‘‘H9’’ infour individuals of A. arbustorum (A,B,C,D). Resources ofDNA are: T, foot tissue, ca. 20 mg; F, foot mucus; S, shellperiostracum. Genotypes at ‘‘26’’: A = aa, B = ab, C = cc,D = ac. Genotypes at ‘‘H9’’: A = ab, B = aa, C = cc, D = cc.Black arrows indicate prominent heteroduplex signals. M =M3 size marker (Elchrom Scientiﬁc AG).315Hedmark E, Flagstad Ø, Segerstro¨m P, Persson J, Landa A,Ellegren H (2004) DNA-based individual and sex identiﬁ-cation from wolverine (Gulo gulo) faeces and urine. Conserv.Genet., 5, 405–410.Idaghdour Y, Broderick D, Korrida (2003) Faeces as a sourceof DNA for molecular studies in a threatened population ofgreat bustards. Conserv. Genet., 4, 789–792.Locher R, Baur B (2001) Isolation of microsatellite markers inthe hermaphroditic land snail Arianta arbustorum (Gastro-poda). Mol. Ecol. Notes, 1, 39–40.Luchtel DJ, Deyrup-Olson I (2001) Body wall and function. In:The Biology of Terrestrial Molluscs (ed. Barker GM), pp.147–178. CABI Publishing, Oxon.Parsons KM (2001) Reliable microsatellite genotyping ofdolphin DNA from faeces. Mol. Ecol. Notes, 1, 341–344.QIAGEN (2003) DNeasy, Tissue Handbook. July 2003. Proto-col: Isolation of Total DNA from Animal Tissues, pp. 18–20.QIAGEN AG, Basel, Switzerland.Raymond M, Rousset F (1995) GENEPOP (version 1.2):population genetics software for exact tests and ecumeni-cism. J. Hered., 86, 248–249.Sefc KM, Payne RB, Sorenson MD (2003) Microsatelliteampliﬁcation from museum feather samples: eﬀects of frag-ment size and template concentration on genotyping errors.Auk, 120, 982–989.Taberlet P, Luikart G (1999) Non-invasive genetic samplingand individual identiﬁcation. Biol. J. Linn. Soc., 68, 41–55.Tenzer I, degli Ivanissevich S, Morgante M, Gessler C (1999)Identiﬁcation of microsatellite markers and their applicationto population genetics of Venturia inaequalis. Phytopathology,89, 748–753.Wisely SM, Maldonado JE, Fleischer RC (2004) A technique forsampling ancient DNA that minimizes damage to museumspecimens. Conserv. Genet., 5, 105–107.316

Foot mucus and periostracum fraction as non-destructive source of DNA in the land snail Arianta arbustorum , and the development of new microsatellite loci

http://doc.rero.ch/record/312202/files/10592_2004_Article_7823.pdf

Foot mucus and periostracum fraction as non-destructive source of DNA in the land snail Arianta arbustorum , and the development of new microsatellite loci

Abstract

Similar works

Full text

Available Versions

RERO DOC Digital Library