The Next Generation Sequencing (pyrosequencing) technique allows rapid, low-cost development of microsatellite markers. We have used this technology to develop 14 polymorphic loci for the endangered meadow viper (Vipera ursinii). Based on 37,000 reads, we developed primers for 66 microsatellite loci and found that 14 were polymorphic. The number of alleles per locus varies from 1 to 12 (for 30 individuals tested). At a cost of about 1/3 that of a normal microsatellite development, we were able to define enough microsatellite markers to conduct population genetic studies on a non-model specie

Ferchaud, Anne-Laure

Geiser, Céline

Metzger, César

Ursenbacher, Sylvain

RERO DOC Digital Library

TECHNICAL NOTENew polymorphic microsatellite markers of the endangeredmeadow viper (Vipera ursinii) identified by 454 high-throughputsequencing: when innovation meets conservationCe´sar Metzger • Anne-Laure Ferchaud •Ce´line Geiser • Sylvain UrsenbacherReceived: 3 February 2011 / Accepted: 13 February 2011 / Published online: 3 March 2011 Springer Science+Business Media B.V. 2011Abstract The Next Generation Sequencing (pyrose-quencing) technique allows rapid, low-cost development ofmicrosatellite markers. We have used this technology todevelop 14 polymorphic loci for the endangered meadowviper (Vipera ursinii). Based on 37,000 reads, we devel-oped primers for 66 microsatellite loci and found that 14were polymorphic. The number of alleles per locus variesfrom 1 to 12 (for 30 individuals tested). At a cost of about1/3 that of a normal microsatellite development, we wereable to define enough microsatellite markers to conductpopulation genetic studies on a non-model species.Keywords Conservation genomics  Microsatellite Vipera ursinii  454 sequencingIntroductionThe recent advent of next-generation, high-throughputsequencing technology and the improvement of moretraditional techniques has allowed biologists to venture intothe study of the population genetic structure of non-modelorganisms, which was previously so time-consuming andexpensive (Abdelkrim et al. 2009; Santana et al. 2009) thata population study of rare and/or cryptic species was rarelyattempted. Paradoxically, the importance of studying hab-itat fragmentation, gene flow and hybridization in suchspecies is higher due to their higher sensitivity to envi-ronmental perturbations (e.g. Spielman et al. 2004).An array of molecular tools has been useful in conser-vation genetics and some of the most commonly usednowadays are microsatellite markers (Frankham et al. 2002;Goldstein and Schlo¨tterer 1999). In the field of reptileconservation genetics, only a few microsatellite markers fora limited number of species (34; based on GenBank andMullin and Seigel 2009) are available out of the 3149 snakespecies listed by the EMBL Reptile Database. Vipers are themost intensively studied group in Europe but specificprimers have only been developed for one of them (V. be-rus: Carlsson et al. 2003; Ursenbacher et al. 2009).The meadow viper (Bonaparte, 1835) is a widespreadpalaearctic Viperidae ranging from southeastern France tonorthwestern China. Nonetheless, this species is one of themost threatened snake species in Europe owing to itshighly fragmented habitat (Ferchaud et al. 2011). Thisspecies is classified as endangered (EN) on the IUCN RedList of Threatened Species, strictly protected under CITES(Appendix I and II) and the Bern Convention. Scientificresearch has focused on different aspects, including popu-lation dynamics (Baron et al. 1996; Ferrie`re et al. 1996),cohabitation with other species (Agrimi and Luiselli 1992;Luiselli et al. 2007), genetic diversity reduction (Ujvariet al. 2002, 2005) and population fragmentation (Ferchaudet al. 2011). However, no specific microsatellite locus hasyet been isolated for this snake.C. Metzger  C. Geiser  S. Ursenbacher (&)Department of Environmental Sciences, Section of ConservationBiology, University of Basel, St-Johanns-Vorstadt 10,4056 Basel, Switzerlande-mail: s.ursenbacher@unibas.chPresent Address:C. MetzgerZoological Institute, University of Basel, Vesalgasse 1,4051 Basel, SwitzerlandA.-L. FerchaudLaboratoire Bioge´ographie et Ecologie des Verte´bre´s,Ecole Pratique de Hautes Etudes, Centre d’EcologieFonctionnelle et Evolutive CNRS, 1919 Route de Mende,34293 Montpellier Cedex 5, France123Conservation Genet Resour (2011) 3:589–592DOI 10.1007/s12686-011-9411-xHere, we describe the characterization of 15 microsat-ellite loci for V. ursinii using next generation pyrose-quencing methods and tested their polymorphism in aFrench population.Materials and methodsWe harvested DNA from a stillborn specimen sampledfrom the population 1 mentioned in Ferchaud et al. (2011).The extraction was done with a Qiagen DNeasy kit andDNA (&10–15 ng) was sent to Microsynth AG (Balgach,Switzerland) for random 454 pyrosequencing and genomiclibrary building. The genomic data was screened forpotential microsatellites using MSATCOMMANDERv0.8.2 (Faircloth 2008) and a final selection was based onthe length and the homogeneity of their repetitions. Twoprimers were designed for each selected microsatellite andthe results of the PCR were examined by electrophoresisin a 1.5% agarose gel. A first selection of potential poly-morphic loci was done with a QIAxcel machine (Qiagen,Hombrechtikon, Switzerland), using a QIAxcel DNA high-resolution kit (Qiagen). Subsequently, polymorphism of themicrosatellite loci was tested for 30 samples of the popu-lation 3 (Ferchaud et al. 2011) with an ABI Prism 3130XLsequencer. The null allele occurrence was tested for eachlocus using MICRO-CHECKER v2.2.3 (Van Oosterhoutet al. 2004). Observed (Ho) and expected (He) heterozy-gosity, deviation from Hardy–Weinberg Equilibrium(HWE) and genetic disequilibrium were calculated for eachgenetic marker using FSTAT v2.9.3 (Goudet 1995).Results and discussionThe 454 sequencing provided 37,227 reads and MSTAT-COMMANDER selected 3228 microsatellite loci (Table 1).Similar numbers of di-, tri- and tetranucleotide microsatel-lites were detected with a higher number of repetitions fordinucleotides (mean, minimum–maximum repetitions 12.8,6–193; 8.64, 4–27; and 8.10, 4–42, respectively). Wedesigned primer pairs for 66 microsatellite loci, but PCRproducts were obtained from only 44 microsatellite loci. Afirst test of polymorphism with the QIAxcel system sug-gested that 15 markers could be polymorphic.Finally, primer pairs were combined to allow theamplification of all loci in five multiplex PCR reactions inorder to amplify up to 4 loci in the same 10 ll PCRreaction (PCR conditions are given in Table 2). Thenumber of alleles per locus ranged from 1 (Vu11 andVu36) to 12 (Vu58) with expected heterozygosity values inthe range 0.000–0.859 (Table 1). Only 1 (Vu52) micro-satellite loci tested showed evidence of null alleles andHWE deviation. No evidence of genetic disequilibrium wasdetected.The microsatellite markers developed in this work willbe useful for the study of gene flow and inbreeding in themeadow viper. Based on the high throughput availableTable 1 Summary of the methodological test used to develop microsatellite markers from random sequencing using a next generation sequencer(454 pyrosequencing) and the proportion of usable microsatellite loci at each stepStep No. microsatellite loci RemarksRandom sequencing on 1/16th plateof a 454 sequencer (Roche)Reads: 37,227 Mean length: 316.2 bpSelection of microsatellites usingMSATCOMMANDER V0.8.2(Faircloth 2008)Microsatellite loci: 3228(but only 2462 for whichpotential primers could bedesigned)Dinucleotides: 762Trinucleotides: 780Tetranucleotides: 920Secondary selection of microsatelliteloci with a long and stable numberof repeatsMicrosatellite loci: 66 Dinucleotides: 25Trinucleotides: 21Tetranucleotides: 20This selection was subjective and numerous additionalmicrosatellite loci could have been testedAmplification and control of PCRproduct on agarose gelMicrosatellite loci: 44 After a few PCR tests with different temperatures and MgCl2concentration, we were unable to amplify 22 microsatellite lociwith a clear and repeatable signalPolymorphism test with QIAxcelsystem (Qiagen)Microsatellite loci polymorphic:15 of the 44Polymorphism test with capillarysequencerMicrosatellites polymorphic in thepopulation 3 (Ferchaud et al. 2011):13 of the 15One non-polymorphic microsatellite locus in population 3 ispolymorphic in other populations (Ferchaud pers. comm.)590 Conservation Genet Resour (2011) 3:589–592123Table2Characteristicsof15microsatellitelociinViperaursiniitestedwith30samplesofonepopulation(population3;Ferchaudetal.2011)LocusPrimerpairsequence(50 –30 )RepeatedmotifAnealingtemperature(C)MgCl 2concentration(mM)MultiplexreactionLength(bp)NumberofallelesHEHOOccurrenceofnullallelesVu39GGCATGGTGGAAGGGACC(AAT) 14603.5Reaction117230.4440.412NoCGTTGTATTTGCTTGTTCCTGCVu38GGAAATCTGGTTGGAGCCCCC(AC) 21603.5Reaction117340.6350.559NoGCACTGTCTGTCACACCVu36TCTGTGGGCTAACACCTGC(GT) 19603.5Reaction117410.0000.000NoTCTCCAGTTCATGTACCAGCVu29GTAGGAGTCACTTGCTC(CTA) 13603.5Reaction118950.7950.824NoGTTCATGGTCCTGTCCCTTTGGVu55GGTTGTGGATCTCTGACG(CAT) 10603.5Reaction215420.5050.529NoGAGAACTCCCAACTCCAGGCVu58GCTGTCTAGTTTAATGGACCTGTC(TCTA) 16TCA603.5Reaction2190120.8590.912NoGAAGTTGAGAGGCTAATAAATCCAG(TCTA) 2Vu18TGTTGCTGCCCATCTTGTC(CT) 4TT(CT) 10603.5Reaction227420.2100.235NoTGTCAAATATCAAGTCAGTTGCCVu57GGAGTTGAAACAGTGTATGTCCAG(CA) 18603.5Reaction217280.8310.882NoCCAGGGCGAATAGTCCTCVu26TAGGGTTTCCTGCCTGAGC(CAT) 9603.5Reaction323820.2110.176NoCCTGGGTTACAAAGTCTCCVu42GGTTAATCAATCACGATAGCACCTCCG(AAC) 7601.5Reaction317820.3490.324NoCACAGAGCAACATCTGCCACAGVu32TCTTTGGCTGCTTCAAGATTAG(CA) 18501.5Reaction415230.6150.588NoGCAGTAAGATGGAATTGGVu16TCATTCTGGCTCTAATACCACATC(ATTT) 13551.5Reaction418140.6260.588NoGGAGGAAATGAGAAGACTGGCVu11GCTTCCAGGCAGAAGGCG(AGG) 10551.5Reaction416910.0000.000NoTTCCCTTTGTCCACCCAGCVu52GTATAGGGTGTCCTCC(ATG) 16603.5Reaction519240.7030.176YesCCAGAGTCTGTGAGGAAGCCCVu4CAACTCGCAGCCAAACC(GAT) 9603.5Reaction515330.2580.294NoTCGCCATCACTGGTACAGGConservation Genet Resour (2011) 3:589–592 591123using next generation sequencing, the rapid development ofnumerous microsatellite loci can be achieved with limitedcost (in this study, the cost was about 1/3 that of a normalorder). In addition, this method can provide hundredsof polymorphic primers (in our case, 21% of the devel-oped loci were polymorphic) for non-model organisms.Consequently, we recommend that scientists interestedin population genetics use this methodology to reducedevelopmental costs of new microsatellite markers for non-model species.Acknowledgments The authors are grateful to Jean-Pierre Baronand Arnaud Lyet for providing the samples and thank MatthieuRaemy and Hans-Peter Rusterholz (University of Basel) for help inthe laboratory. Polymorphism was tested through the moleculargenetic analysis technical facilities of the IFR119 ‘‘MontpellierEnvironnement Biodiversite´’’.ReferencesAbdelkrim J, Robertson B, Stanton JA, Gemmell N (2009) Fast, cost-effective development of species-specific microsatellite markersby genomic sequencing. Biotechniques 46:185–192Agrimi U, Luiselli L (1992) Feeding strategies of the Viper Viperaursinii ursinii (Reptilia, Viperidae) in the Apennines. HerpetologJ 2:37–42Baron JP, Ferrie`re R, Clobert J, Saint Girons H (1996) Life history ofVipera ursinii ursinii at Mont-Ventoux (France). C R Acad SciSer III 319:57–69Carlsson M, Isaksson M, Hoggren M, Tegelstro¨m H (2003) Charac-terization of polymorphic microsatellite markers in the adder,Vipera berus. Mol Ecol Notes 3:73–75Faircloth BC (2008) MSATCOMMANDER: detection of microsat-ellite repeat arrays and automated, locus-specific primer design.Mol Ecol Resour 8:92–94Ferchaud A-L, Lyet A, Cheylan M, Arnal V, Baron JP, Mongelard C,Ursenbacher S (2011) High genetic differentiation among Frenchpopulations of the Orsini’s meadow viper (Vipera ursinii ursinii)based on mitochondrial and microsatellite data: implications forconservation management. J Hered 102:67–78Ferrie`re R, Sarrazin F, Legendre S, Baron JP (1996) Matrixpopulation models applied to viability analysis and conservation:theory and practice using the ULM software. Acta Oecol Int JEcol 17:629–656Frankham R, Ballou JD, Briscoe DA (2002) Introduction to conser-vation genetics. Cambridge University Press, CambridgeGoldstein DB, Schlo¨tterer C (1999) Microsatellites: evolution andapplications. Oxford University Press, OxfordGoudet J (1995) FSTAT (Version 1.2): a computer program tocalculate F- statistics. J Hered 86:485–486Luiselli L, Filippi E, Di Lena E (2007) Ecological relationshipsbetween sympatric Vipera aspis and Vipera ursinii in high-altitude habitats of central Italy. J Herpetol 41:378–384Mullin SJ, Seigel RA (2009) Snakes: ecology and conservation.Cornell University, New YorkSantana Q, Coetzee M, Steenkamp E, Mlonyeni O, Hammond G,Wingfield M, Wingfield B (2009) Microsatellite discovery bydeep sequencing of enriched genomic libraries. Biotechniques46:217–223Spielman D, Brook BW, Frankham R (2004) Most species are notdriven to extinction before genetic factors impact them. ProcNatl Acad Sci USA 101:15261–15264Ujvari B, Madsen T, Kotenko T, Olsson M, Shine R, Wittzell H(2002) Low genetic diversity threatens imminent extinction forthe Hungarian meadow viper (Vipera ursinii rakosiensis). BiolConserv 105:127–130Ujvari B, Madsen T, Olsson M (2005) Discrepancy in mitochondrialand nuclear polymorphism in meadow vipers (Vipera ursinii)questions the unambiguous use of mtDNA in conservationstudies. Amphib Reptil 26:287–292Ursenbacher S, Monney J-C, Fumagalli L (2009) Limited geneticdiversity and high differentiation among the remnant adder(Vipera berus) populations in the Swiss and French JuraMountains. Conserv Genet 10:303–315Van Oosterhout C, Hutchinson WF, Wills DPM, Shipley P (2004)MICRO-CHECKER: software for identifying and correctinggenotyping errors in microsatellite data. Mol Ecol Notes 4:535–538592 Conservation Genet Resour (2011) 3:589–592123

New polymorphic microsatellite markers of the endangered meadow viper ( Vipera ursinii ) identified by 454 high-throughput sequencing: when innovation meets conservation

http://doc.rero.ch/record/313743/files/12686_2011_Article_9411.pdf

New polymorphic microsatellite markers of the endangered meadow viper ( Vipera ursinii ) identified by 454 high-throughput sequencing: when innovation meets conservation

Abstract

Similar works

Full text

Available Versions

RERO DOC Digital Library