Stethophyma grossum is a threatened Eurosiberian grasshopper species. Since it is bound to wetlands, S. grossum is often used as indicator for extensive wet meadows. To study its movement capability and dispersal habitat in landscape genetic analyses, we developed ten polymorphic microsatellite markers, making use of next generation sequencing. Markers were tested on 75 individuals collected in five populations from Switzerland. We found four to 18 alleles per locus. Observed and expected heterozygosities varied between 0.215-0.893 and 0.397-0.831, respectively. One marker seems to be sex-chromosome X-linked and one showed high null allele frequencies, a phenomenon generally detected in microsatellite studies on grasshopper

Holderegger, Rolf

Jung, Esther

Keller, Daniela

RERO DOC Digital Library

TECHNICAL NOTEDevelopment of microsatellite markers for the wetlandgrasshopper Stethophyma grossumDaniela Keller • Esther Jung • Rolf HoldereggerReceived: 23 November 2011 / Accepted: 1 December 2011 / Published online: 16 December 2011 Springer Science+Business Media B.V. 2011Abstract Stethophyma grossum is a threatened Eurosi-berian grasshopper species. Since it is bound to wetlands,S. grossum is often used as indicator for extensive wetmeadows. To study its movement capability and dispersalhabitat in landscape genetic analyses, we developed tenpolymorphic microsatellite markers, making use of nextgeneration sequencing. Markers were tested on 75 indi-viduals collected in five populations from Switzerland.We found four to 18 alleles per locus. Observed andexpected heterozygosities varied between 0.215–0.893 and0.397–0.831, respectively. One marker seems to be sex-chromosome X-linked and one showed high null allelefrequencies, a phenomenon generally detected in micro-satellite studies on grasshoppers.Keywords Conservation  Next generation sequencing Orthoptera  SSRs  Stethophyma grossumThe large marsh grasshopper Stethophyma grossum (Lin-naeus, 1758; Acrididae) is distributed throughout Europeand Siberia and is strictly bound to wetlands (Baur et al.2006). Therefore, S. grossum is often used as an indicatorspecies for extensively managed wet meadows. Due tothe decline and fragmentation of wet meadows during thelast decades, many populations of S. grossum have becomespatially isolated or extinct. In Switzerland, the species iscurrently red listed as vulnerable (Monnerat et al. 2007).To plan effective conservation management strategies forthis threatened grasshopper, knowledge on its movementcapabilities and dispersal habitat is required. Landscapegenetic approaches can help investigating these issues(Segelbacher et al. 2010). Microsatellites have widely beenused in these analyses, but no markers had been availablefor species of the Stethophyma genus. Here, we describethe development of ten polymorphic microsatellite markersfor S. grossum, making use of next generation sequencing(Csencsics et al. 2010).DNA of one individual (tibia and tarsus) was extractedand shotgun sequenced (1/16th run) at Microsynth AG(Balgach, Switzerland) using a Roche 454 GenomeSequencer FLX with the Titanium sequencing kit XLR 70.Details can be found in Margulies et al. (2005). We obtaineda total of 52,693 reads with an average read length of355 bp. MSATCOMMANDER 0.8.2 (Faircloth 2008) wasused to search for di-, tri- and tetra-nucleotides in unas-sembled sequences. We limited the search to dinucleotidesof at least eight, trinucleotides of at least ten and tetranu-cleotides of at least six repeats. A large number of repeats(1,059) matched with these criteria, and primers weredesigned for 121 repeats using PRIMER3 (Rozen andSkaletsky 2000). CLC SEQUENCE VIEWER 6.0.2 (CLCbio Anhus, Denmark) was used to check the 121 sequencesfor possible duplicate microsatellite loci. Three sequencepairs were matching and we thus removed all duplicates,resulting in 118 repeats (84 di-, 21 tri-, 22 tetra-nucleo-tides). Finally, fifty sequences were chosen for furthertesting. DNA was extracted from grasshopper legs (tibiaand tarsus), which were stored in 100% ethanol at -20C inthe dark after collecting. Samples were first lyophilised,ground with an MM300 mixer mill for 4 min (Retsch) andthen extracted using the DNeasy Blood and Tissue Kit(Qiagen) according to the manufacturer’s protocol includ-ing the changes recommended for insects. As tibiae of midlegs were only small, half of the recommended quantities ofD. Keller (&)  E. Jung  R. HoldereggerWSL Swiss Federal Research Institute, Zu¨rcherstrasse 111,8903 Birmensdorf, Switzerlande-mail: daniela.keller@wsl.ch123Conservation Genet Resour (2012) 4:507–509DOI 10.1007/s12686-011-9586-1extraction chemicals were taken, and elution was performedtwice with each 75 ll elution buffer. Seven samples, allcollected in different populations in central Switzerland,were used for preliminary testing of all 50 microsatellitemarkers. Microsatellite amplification was performed withthe M13 method (Schuelke 2000). PCR reaction volumes(10 ll) contained approximately 0.7 ng of diluted genomicDNA, 5 ll 29 Multiplex Mix (Qiagen), ddH2O, 0.01 lM offorward primer and 0.15 lM of each reverse and universalFAM-labelled M13 primers (Schuelke 2000). Amplifica-tions were run on ABI Verity thermocyclers (AppliedBiosystems) with polymerase activation at 94C for 15 min,followed by 30 cycles of 94C for 30 s, 60C for 90 s and72C for 60 s, and an additional eight cycles of 94C for30 s, 53C for 90 s and 72C for 60 s, followed by a finalelongation step at 72C for 30 min. Fragments were ana-lysed on an ABI 3130 sequencer (Applied Biosystems) andelectropherograms were scored with GENEMAPPER 3.7(Applied Biosystems). Only 10 out of the 50 markers testedwere polymorphic and showed clear and reproducible pat-terns. We tested these ten markers on five populations with15 individuals each, collected in central Switzerland in anarea of about 50 km2. Calculations of number of alleles perlocus, observed and expected heterozygosities and a test forlinkage disequilibrium were performed in FSTAT 2.9.3.2.(Goudet 1995). Departure from Hardy–Weinberg equilib-rium was tested in GENEPOP 4.0.10. (Raymond andRousset 1995) using Fisher’s exact test. Frequencies of nullalleles were estimated for each marker with FREENA(Chapuis and Estoup 2007).For the five populations tested, we found four to eighteenalleles per locus (Table 1). Observed and expected hetero-zygosities varied between 0.215–0.893 and 0.397–0.831,respectively. Linkage disequilibrium was detected forthree primer combinations (P B 0.05), but they were nolonger significant after Bonferroni correction (P C 0.001).Deviations from Hardy–Weinberg equilibrium were foundfor locus Sgr07 and Sgr29. Locus Sgr29 seemed to besex-chromosome X-linked. At this locus, males were allhomozygous while approximately 50% of females wereheterozygous. Females of S. grossum are XX and males X0(Perry and Jones 1974). For locus Sgr07, however, devia-tions from Hardy–Weinberg equilibrium were probablycaused by the presence of null alleles (at a frequency C0.2;Table 1). High frequencies of null alleles are often found inorthopteran species (e.g. Ustinova et al. 2006; Chapuis et al.Table 1 Characteristics of ten microsatellite loci developed for Stethophyma grossum and tested for a total of 75 individuals collected from fivelocations in SwitzerlandLocus Primer sequences (50–30) RepeatmotifNA Size range(bp)Ho He HWE test Null allelefrequencyGenBankaccessionnumberSgr07 F: TATGCACAGGGATGGGAGCR: TTGTCCTCGTCACATGCAG(ATT)12 10 289–319 0.307 0.736 \0.05 0.232 JQ026312Sgr10 F: CTTTCCCGAAGCCCACAAGR: TGCAACAAGTCTGCTTACCG(AAT)15 7 158–203 0.667 0.676 0.431 0.029 JQ026313Sgr13 F: TGATGGCTGAACATCCCGCR: CCAAATCCGCTTCACAACG(AAT)12 11 298–342 0.710 0.726 0.332 0.029 JQ026314Sgr14 F: TTCCACAGAAAGGTGGGTCR: AGTTTGCATATCACCCGTTTG(AC)12 16 264–344 0.597 0.673 0.087 0.047 JQ026315Sgr15 F: CCACCGTGTGATACTTGGCR: CGGCGTTTCCCGTCTATTTAC(AG)8 12 163–203 0.607 0.656 0.479 0.034 JQ026316Sgr19 F: GATAGCTTTCAGGTTAGTTGGGR: TCCTCCGACCTTCGAACTG(ATT)11 8 229–259 0.779 0.761 0.485 0.014 JQ026317Sgr29 F: TCAAGTCCCTATCAAGCACGR: ACGCAGTTCGGTGTTATCG(AC)8 7 312–324 0.215 0.538 \0.05* – JQ026318Sgr38 F: GGCCAATGTATGACGAGGGR: CTGATGACCTCGCTGTTTGG(GT)8 18 186–290 0.893 0.831 0.971 0.002 JQ026319Sgr40 F: TGTGACTTTATTTATCTGGTGGCTCR: TATATCCGACGTGGCTCCC(AAAT)6 4 304–316 0.283 0.397 0.075 0.080 JQ026320Sgr45 F: CTAGCCTGGTCATCAGTCCCR: AGAGAGACACGCTATGTGC(AC)8 7 282–300 0.573 0.654 0.464 0.052 JQ026321* X-linked marker primer sequence (F: forward, R: reverse), number of alleles (NA), observed heterozygosity (Ho), expected heterozygosity (He)and P value of test for Hardy–Weinberg equilibrium (HWE)508 Conservation Genet Resour (2012) 4:507–5091232008; Blanchet et al. 2010). Thus, it is important to care-fully check loci for the presence of null alleles in each studyand to exclude loci with high frequencies of null alleles.Of the presented microsatellites, eight (excluding Sgr07and Sgr29 for previously mentioned reasons) will serve asmarkers for a landscape genetic study focussing on thedispersal of S. grossum in a fragmented landscape. Resultswill help to develop guidelines for the conservation man-agement of this grasshopper species.Acknowledgments We want to thank Maarten van Strien for helpwith field work, the CCES-ENHANCE project of the ETH domain forfinancial support and the Swiss Cantons of Berne, Solothurn, Aargauand Lucerne for sampling permissions.ReferencesBaur B, Baur H, Roesti C, Roesti D (2006) Die Heuschrecken derSchweiz. Haupt, BernBlanchet E, Pages C, Blondin L, Billot C, Rivallan R, Vassal JM, LecoqM, Risterucci AM (2010) Isolation of microsatellite markers in theCalliptamus genus (Orthoptera, Acrididae). J Insect Sci 10:133Chapuis MP, Estoup A (2007) Microsatellite null alleles andestimation of population differentiation. Mol Biol Evol 24:621–631. doi:10.1093/molbev/msl191Chapuis MP, Popple JA, Simpson SJ, Estoup A, Martin JF, SteinbauerM, McCulloch L, Sword GA (2008) Eight polymorphic microsat-ellite loci for the Australian plague locust, Chortoicetes terminif-era. Mol Ecol Resour 8:1414–1416. doi:10.1111/j.1755-0998.2008.02204.xCsencsics D, Brodbeck S, Holderegger R (2010) Cost-effective,species-specific microsatellite development for the endangereddwarf bulrush (Typha minima) using next-generation sequencingtechnology. J Hered 101:789–793. doi:10.1093/jhered/esq069Faircloth BC (2008) MSATCOMMANDER: detection of microsat-ellite repeat arrays and automated, locus-specific primer design.Mol Ecol Resour 8:92–94. doi:10.1111/j.1471-8286.2007.01884.xGoudet J (1995) FSTAT (version 1.2): a computer program tocalculate F-statistics. J Hered 86:485–486Margulies M, Egholm M, Altman WE et al (2005) Genome sequencing inmicrofabricated high-density picolitre reactors. Nature 437:376–380.doi:10.1038/nature03959Monnerat C, Thorens P, Walter T, Gonseth Y (2007) Rote Liste dergefa¨hrdeten Arten der Schweiz: Heuschrecken. BAFU, BernPerry PE, Jones GH (1974) Male and female meiosis in grasshoppersI. Stethophyma grossum. Chromosoma 47:227–236. doi:10.1007/BF00328858Raymond M, Rousset F (1995) GENEPOP (version 1.2). Populationgenetics software for exact tests and ecumenicism. J Hered 86:248–249Rozen S, Skaletsky H (2000) PRIMER3 on the www for general usersand for biologist programmers. In: Krawetz S, Misener S (eds)Bioinformatics methods and protocols: methods in molecularbiology. Humana Press, Totowa, pp 365–386Schuelke M (2000) An economic method for the fluorescent labelingof PCR fragments. Nat Biotechnol 18:233–234. doi:10.1038/72708Segelbacher G, Cushman SA, Epperson BK, Fortin MJ, Francois O,Hardy OJ, Holderegger R, Taberlet P, Waits LP, Manel S (2010)Applications of landscape genetics in conservation biology: con-cepts and challenges. Conserv Genet 11:375–385. doi:10.1007/s10592-009-0044-5Ustinova J, Achmann R, Cremer S, Mayer F (2006) Long repeats in ahuge genome: microsatellite loci in the grasshopper Chorthippusbiguttulus. J Mol Evol 62:158–167. doi:10.1007/s00239-005-0022-6Conservation Genet Resour (2012) 4:507–509 509123

Development of microsatellite markers for the wetland grasshopper Stethophyma grossum

http://doc.rero.ch/record/311009/files/12686_2011_Article_9586.pdf

Development of microsatellite markers for the wetland grasshopper Stethophyma grossum

Abstract

Similar works

Full text

Available Versions

RERO DOC Digital Library