We isolated and characterized eight microsatellite markers for Dictyochloropsis reticulata, the primary photosynthetic partner of the epiphytic lichen Lobaria pulmonaria. These are the first microsatellite loci reported for a lichen symbiotic alga. These polymorphic markers will be useful for investigating spatial genetic structure, biogeography and dispersal of this eukaryotic alga and will generally shed light on the coevolution of the green-algal lichen symbiose

Beck, Andreas

Dal Grande, Francesco

Scheidegger, Christoph

Widmer, Ivo

RERO DOC Digital Library

TECHNICAL NOTEMicrosatellite markers for Dictyochloropsis reticulata(Trebouxiophyceae), the symbiotic alga of the lichen Lobariapulmonaria (L.)Francesco Dal Grande Æ Ivo Widmer ÆAndreas Beck Æ Christoph ScheideggerReceived: 19 March 2009 / Accepted: 21 March 2009 / Published online: 1 April 2009 Springer Science+Business Media B.V. 2009Abstract We isolated and characterized eight microsat-ellite markers for Dictyochloropsis reticulata, the primaryphotosynthetic partner of the epiphytic lichen Lobariapulmonaria. These are the first microsatellite loci reportedfor a lichen symbiotic alga. These polymorphic markerswill be useful for investigating spatial genetic structure,biogeography and dispersal of this eukaryotic alga and willgenerally shed light on the coevolution of the green-algallichen symbioses.Keywords Coevolution  Lobaria pulmonaria Photobiont  Population genetics  SSRIntroductionThe foliose tripartite lichen Lobaria pulmonaria hasbecome an important model species for studies on thebiological conservation of epiphytic lichens, because of itswide geographical distribution (Yoshimura 1998) and itsvalue as a bioindicator of long ecological continuity(Gauslaa 1994). While L. pulmonaria is widespread andlocally common in boreal North America (Brodo et al.2001), it suffered a serious decline in many parts of CentralEurope during the twentieth century (Wirth et al. 1996).Despite the amount of available biological and geneticinformation for the fungal partner of this symbiosis (e.g.Walser et al. 2005; Werth et al. 2007), little is known aboutits primary photosymbiotic partner, namely the eukaryoticgreen alga Dictyochloropsis reticulata (Trebouxiophyceae;Geitler 1966), primarily because of a lack of informativegenetic markers. In order to develop efficient strategies toconserve and enhance L. pulmonaria populations, moreinformation is needed about patterns of genetic variation atdifferent spatial scales for the algal part of the symbiosis.In this paper, we describe the isolation and characterizationof eight informative microsatellite markers for D. reticu-lata, to provide adequate tools for correspondingpopulation-level studies. To our knowledge, these are thefirst ones for a lichen symbiotic alga.Following the method of Beck and Koop (2001), anaxenic culture of D. reticulata was obtained and grownfrom a single algal cell isolated from a specimen ofL. pulmonaria from Pamplona, Spain; voucher specimen6577 (herbarium of the Swiss Federal Research InstituteWSL, Birmensdorf), algal culture AB06.006A2 (algalculture collection of the Botanische Staatssammlung,Munich). Genomic DNA was extracted from 20 mg ofvegetative cells of D. reticulata using the DNeasy PlantMini Kit (QIAGEN, Hilden, Germany) following themanufacturer’s protocol. An enriched library was made byecogenics GmbH (Zurich, Switzerland) from size selectedgenomic DNA ligated into SAULA/SAULB-linker(Armour et al. 1994) and enriched by magnetic beadselection with biotin-labelled (GT)13, (CT)13, (TAC)10 and(AAC)10 oligonucleotide repeats (Gautschi et al. 2000a, b).Of the 754 recombinant colonies screened, 127 gave apositive signal after hybridization. Plasmids from 104positive clones were sequenced and primers were designedfor 20 microsatellite inserts using PRIMER3 (Rozen andSkaletsky 2000). The 20 primer pairs were tested for PCR-F. Dal Grande (&)  I. Widmer  C. ScheideggerBiodiversity and Conservation Biology, WSL Swiss FederalResearch Institute, Zu¨rcherstrasse 111, 8903 Birmensdorf,Switzerlande-mail: francesco.dalgrande@wsl.chA. BeckDepartment of Lichenology and Bryology, BotanischeStaatssammlung Mu¨nchen, 80638 Munich, Germany123Conserv Genet (2010) 11:1147–1149DOI 10.1007/s10592-009-9904-2Table1PrimerpairsandcharacteristicsofeightpolymorphicmicrosatellitelociforDictyochloropsisreticulataLocusRepeatmotifPrimersequence(50 –30 )DyelabelTa(C)Size(bp)AGenediversitybGenBankaccessionno.LPh1(AT) 3(GT) 23F:GTCTCAGGTGACCACTTGATTGaVIC62252–494410.991FJ754261R:GCAATGGATATGATGCTTGTTCLPh2(CT) 16F:GACAGCTGTTCCAGTGCATC6FAM62155–15930.370FJ754262R:GCAGAGGAAGTGCATGACGaLPh3(CA) 15F:TGCAGTAGGTGTCATATGTGTaNED62106–11240.610FJ754263R:GAAGGCGCATCTTGATATACLPh4(AG) 27AT(AG) 5F:GTGGTGGTACAACATGCTCAaNED62183–19980.687FJ754264R:ACGACCACGTGGGATATCTALPh5(TG) 24TA(TG) 2F:TGGTGTTAGTAAGAATCGGCATCaPET62143–15140.447FJ754265R:GTGTATGTCGGCCCCAATAALPh6(TGT) 10F:GAATCCTGCCTGCCTACAAGa6FAM62121–12730.076FJ754266R:AGCAACCCATTTCAACCAACLPh7(TTG) 20TTT(TTG) 4TTT(TTG) 6F:TGTGACAGGTGAAACACCAAaVIC62150–20180.598FJ754267R:TATGGTCCCTCATGGCAAATLPh8(TG) 7TA(TG) 6TA(TG) 3F:GGAAGGTGGTGTGATTGATTa6FAM59151–15320.061FJ754268R:TGCTCCACATTATCACAAACAFforward,Rreverse;Taoptimizedannealingtemperature,Atheobservednumberofalleles.Samplesize,N=60aPrimerlabelledwithdyebGenediversitywascalculatedafterNei(1987)1148 Conserv Genet (2010) 11:1147–1149123amplification with the genomic DNA obtained from theaxenic culture of D. reticulata mentioned above. Six pri-mer pairs failed to amplify, and fourteen were then used toscreen for polymorphism with a sample of 60 specimens ofL. pulmonaria (North Carolina, USA). Total genomic DNAwas extracted from the lichen thalli using the DNeasy 96Plant Kit (QIAGEN, Hilden, Germany) according to themanufacturer’s protocol. PCR reactions for the alga-spe-cific microsatellites were performed on an AppliedBiosystems Veriti thermal cycler (Applied Biosystems,Foster City, CA) in a 10 ll reaction mixture containing 1–10 ng of template DNA, 0.2 lM of each primer and19 Multiplex PCR Kit (QIAGEN, Hilden, Germany). PCRconditions were as follows: 15 min at 95C, 25 cycles of30 s at 94C, 90 s at 62C (or 59C for LPh8), 60 s at 72Cand a final elongation for 30 min at 60C. Genotyping wasperformed on an ABI 3730 Genetic Analyser (AppliedBiosystems, Foster City, CA) and electropherograms wereanalyzed with GENEMAPPER v3.7 using LIZ500 sizestandard (Applied Biosystems, Foster City, CA).Eight of the fourteen tested loci were polymorphic(Table 1). In all individuals, a single allele was recoveredper locus. This indicates that D. reticulata is haploid. Genediversity per locus (Nei 1987) ranged from 0.061 to 0.991,and the number of alleles per locus varied from 2 to 41alleles, resulting in 52 unique multilocus genotypes. Theprimer sequences and other characteristics for the micro-satellite loci are given in Table 1. Linkage disequilibriumin pairwise combinations of the loci was tested usingGENEPOP 4.0 ON THE WEB (Raymond and Rousset1995). After Bonferroni correction, no significant linkagedisequilibrium was detected.These eight microsatellite loci are currently used forstudying the spatial population structure, phylogeographyand dispersal of D. reticulata. Of particular interest is theirapplication to investigate whether different lichen-formingfungi share the same photobiont. When used in combina-tion with the fungus-specific microsatellites for L.pulmonaria (Walser et al. 2003; Widmer et al. in prep.),these markers are a promising tool for studying coevolutionof the green-algal lichen symbiosis.Acknowledgments We thank C Cornejo for laboratory assistance,R Holderegger for valuable comments on the manuscript and TTerzani for his never-ending support. We also thank the GeneticDiversity Center at ETH Zu¨rich, Switzerland (CCED-GDC) fortechnical assistance. We acknowledge financial support from theSwiss National Science Foundation (projects 31003A-105830 and31003A-127346 to Christoph Scheidegger).ReferencesArmour JA, Neumann R, Gobert S, Jeffreys AJ (1994) Isolation ofhuman simple repeat loci by hybridization selection. Hum MolGenet 3:599–605. doi:10.1093/hmg/3.4.599Beck A, Koop H-U (2001) Analysis of the photobiont population inlichens using a single-cell manipulator. Symbiosis 31:57–67Brodo IM, Duran Sharnoff S, Sharnoff S (2001) Lichens of NorthAmerica. Yale University Press, LondonGauslaa Y (1994) Lobaria pulmonaria, an indicator of species-richforests of long ecological continuity. Blyttia 52:119–128Gautschi B, Tenzer I, Mu¨ller JP, Schmid B (2000a) Isolation andcharacterization of microsatellite loci in the bearded vulture(Gypaetus barbatus) and cross-amplification in three Old Worldvulture species. Mol Ecol 9:2193–2195. doi:10.1046/j.1365-294X.2000.105321.xGautschi B, Widmer A, Koella J (2000b) Isolation and characteriza-tion of microsatellite loci in the Dice Snakje (Natrix tessellata).Mol Ecol 3:233–235Geitler L (1966) Die Chlorococcalen Dictyochloris und Dictyochlor-opsis. O¨sterreich Bot Zeitschr 113:155–164Nei M (1987) Molecular evolutionary genetics. Columbia UniversityPress, New YorkRaymond M, Rousset F (1995) GENEPOP (version 1.2): populationgenetics software for exact tests and ecumenicism. J Hered86:248–249Rozen S, Skaletsky H (2000) PRIMER3 on the WWW for generalusers and for biologist programmers. In: Krawetz S, Misener S(eds) Bioinformatics methods and protocols in the seriesmethods in molecular biology. Humana Press, Totowa, pp365–386Walser JC, Sperisen C, Soliva M, Scheidegger C (2003) Fungus-specific microsatellite primers of lichens: application for theassessment of genetic variation on different spatial scales inLobaria pulmonaria. Fungal Genet Biol 40(1):72–82. doi:10.1016/S1087-1845(03)00080-XWalser JC, Holderegger R, Gugerli F, Hoebee SE, Scheidegger C(2005) Microsatellites reveal regional population differentiationand isolation in Lobaria pulmonaria, an epiphytic lichen. MolEcol 14(2):457–467. doi:10.1111/j.1365-294x.2004.02423.xWerth S, Gugerli F, Holderegger R, Wagner HH, Csencsics D,Scheidegger C (2007) Landscape-level gene flow in Lobariapulmonaria, an epiphytic lichen. Mol Ecol 16:2807–2815. doi:10.1111/j.1365-294X.2007.03344.xWirth V, Scholler H, Scholz P et al (1996) Rote Liste der Flechten(Lichenes) der Bundesrepublik Deutschland. Schriftenr Vegeta-tionsk 28:307–368Yoshimura I (1998) Lung lichens and their vegetation in Japan andother regions. In: Kondratyuk SY, Coppins BJ (eds) LobarionLichens as indicators of the primeval forests of the EasternCarpathians. Ukrainian Phytosociological Centre, Kiev, pp 53–63Conserv Genet (2010) 11:1147–1149 1149123

Microsatellite markers for Dictyochloropsis reticulata (Trebouxiophyceae), the symbiotic alga of the lichen Lobaria pulmonaria (L.)

http://doc.rero.ch/record/310992/files/10592_2009_Article_9904.pdf

Microsatellite markers for Dictyochloropsis reticulata (Trebouxiophyceae), the symbiotic alga of the lichen Lobaria pulmonaria (L.)

Abstract

Similar works

Full text

Available Versions

RERO DOC Digital Library