One hundred forty-nine Anopheles gambicie s.l. and 260 A. funestus were collected from the field in Namawala, Tanzania in June 1994. The mosquitoes were dissected and examined for plasmodium oocysts using two microscopic techniques and the polymerase chain reaction (PCR) method. The oldest and simplest technique, the saline test, detected oocysts in 94 out of the 97 mosquitoes found to have oocysts by the more sensitive merbromin stain and PCR techniques. The saline test was found to be a sensitive and reliable field technique for detection of large Plasmodium oocysts in mosquitoes. The merbromin staining technique was as sensitive as PCR, detecting even small oocyst

Edoh, D.

Haji, H.

RERO DOC Digital Library

Insect Sci. Applic. Vol. 18, No. 2, pp. 113-117, 1998Printed in Kenya. All rights reserved0191-9040/98 $3.00 + 0.00©1998 ICIPECOMPARISON OF THREE METHODS FOR DETECTION OFPLASMODIUM OOCYSTS IN WILD-CAUGHT MOSQUITOESD. EDOH1 AND H. HAJI2Tropical Institute, Socinstrasse 57, Postfach, 4002 Basel, Switzerland;2Ifakara Centre, Box 53, Ifakara, Tanzania(Accepted 29 April 1998)Abstract—One hundred forty-nine Anopheles gambiae s.l. and 260 A.funestus were collected from thefield in Namawala, Tanzania in June 1994. The mosquitoes were dissected and examined forplasmodium oocysts using two microscopic techniques and the polymerase chain reaction (PCR)method. The oldest and simplest technique, the saline test, detected oocysts in 94 out of the 97mosquitoes found to have oocysts by the more sensitive merbromin stain and PCR techniques. Thesaline test was found to be a sensitive and reliable field technique for detection of large Plasmodiumoocysts in mosquitoes. The merbromin staining technique was as sensitive as PCR, detecting evensmall oocysts.Key Words: Plasmodium oocysts, mosquitoes, PCR, microscopic techniques, A. gambiae, A.funestusResume—Cent quarante-neuf Anopheles gambiae s.l. et deux cent soixante (260) A.funestus ont etecollectees en juin 1994, dans un champ a Namawala en Tanzanie. Les moustiques etaient dissequeset examines pour la detection des oocysts de Plasmodium par deux techniques microscopiques et parla methode de reaction de la chaine polymerase (RCP). L'emploi de la solution saline, une techniquetres ancienne et tres simple, a permis de detecter des oocytes chez 94 des 97 moustiques ayant dejatemoigne de la presence des oocysts par les techniques tres sensibles: les traces de merbromine et laRCP. Le test par la solution saline s'est revele etre une technique sensible et faible de terrain pourdetecter de gros oocytes chez les moustiques infectes de Plasmodium. La technique des traces demerbromine etait aussi sensible que la RCP detectant meme les petits oocytes.Mots Cles: oocysts de Plasmodium, moustiques, RCP, techiques microscopiques, A. gambiae, A.funestusINTRODUCTIONThe saline test is perhaps the oldest techniquefor the detection of oocysts (see Burkot etal., 1984), and involves simply dissectingthe mosquitoes in physiological saline solutionunder an ordinary dissecting microscopeproviding 200x magnification. Trained eyes canCorresponding author: DE.Present address: Zoology Dept, University of Ghana, Box 67,Legon, Accra, Ghana.E-mail: Edoh@ug.edu.gheasily recognise the oocysts as spherical bodies inthe periphery of the gut, as the gut is pulled andstretched out during dissection. The techniquerequires care in establishing the proper setting ofthe incident light from the microscope to the gut,and is limited by the size of the oocysts.Merbromin is a mercurochrome preparation.A 1% solution in distilled water is used for thedetection of oocysts (Githeko et al., 1992; Smith etal., 1993; Vaughan et al., 1994). The mosquito gut,dissected in saline or distilled water, is transferredto a drop of merbromin solution on a microscope113https:/www.cambridge.org/core/terms. https://doi.org/10.1017/S1742758400007748Downloaded from https:/www.cambridge.org/core. University of Basel Library, on 30 May 2017 at 14:06:10, subject to the Cambridge Core terms of use, available at114 D. EDOH and H. HAJIslide, covered with a cover slip and examinedusing a compound microscope (total magnification200 or 400x). The advantage of this technique isthat the oocysts are well stained, with darkcoloration, which makes it easy to see thecharacteristic features of malaria parasites.Experienced/or well trained workers can detectoocysts as early as two days after an infectiousbloodmeal.The PCR technique is by far the mostcomplicated and expensive of the three techniques(Baker et al , 1994; Edoh, 1995). However, becausethe target DNA molecules can be amplified several-fold, even tiny oocysts can be detected. PCR,however, has to be carried out under sterileconditions to avoid contamination with unwantedDNA molecules. Sterility is required even duringmosquito dissection. Futhermore, it may benecessary to optimise the PCR reaction conditionsin order to obtain reproducible results.In the course of experiments to determine theinfectiousness of Plasmodium falciparumgametocytes for Anopheles gambiae s.l. and A.funestus and to assess the genetic heterogeneity ofoocysts of malaria parasites found in these vectors,an opportunity arose to compare the sensitivity ofabove three methods for the detection of oocystsin mosquito midguts.MATERIALS AND METHODSThe procedure for assessing the performance ofthe tests on vector mosquitoes was as follows:For the saline test, mosquitoes were dissectedin a 0.9% NaCl physiological saline using adissecting microscope and the guts were examinedfor oocysts. During dissection, fresh sterile needleswere used for each mosquito io prevent crosscontamination. For the merbromin test, all theguts that had already been dissected out for thefirst test, regardless of whether they had beennegative or positive, were stained in 1 % merbrominsolution and re-examined under a microscope.Since PCR was to be carried out, the dissection andstaining were performed carefully to avoid cross-contamination.. For the PCR test, all the mosquito gutspreviously examined, whether they had beenfound negative or positive by the first twotechniques, were processed to extract DNA, whichwas then amplified for the detection of merozoitesurface protein, MSP 1, of the major malariaparasite, P. falciparum. The midguts were firstdigested in lysis buffer containing proteinase K at55°C for 1 hour, phenol/chloroform purified andthe parasite DNA pelleted with isopropanol(Ranford-Cartwright et al., 1991). The parasiteDNA, stored at -20°C, was amplified using PCRprimers recognising tandemly repeated aminoacid sequences in Block 2 of MSP-1; first withouter primers 01 and 02 (of sequences 5' to 3''CACATGAAAGTTATCAAGAACTTGTC and'GTACGTCTAATTCATTTGCACG'), then withnested primers Nl and N2 (of sequences 5' to 3''GCAGTATTGACAGGTTATGG' and'GATTGAAAGGTATTTGAC') (Babiker et al.,1994). Amplification was performed at 94 C for 25s; 50°C for 35 s; 68°C for 150 s; for 30 cycles(Ranford-Cartwright et al., 1991).To establish their specificity and sensitivity,the three methods were first tested on 20laboratory-reared mosquitoes obtained from LaRoche Ltd., Basel. Ten mosquitoes were uninfectedand 10 had been infected with P. falciparumgametocyte-enriched cultures through membranefeeding. The study was designed such that noneof the examiners using one of the three tests knewthe other two's findings. All 10 uninfectedmosquitoes were found negative for oocysts bysaline, merbromin and PCR. The 10 infectedmosquitoes were found to contain oocysts by eachof the three methods. This result indicates that allthree tests were highly specific for oocyst detectionin laboratory-reared mosquitoes.Field experiments were carried out in the villageof Namawala, near Ifakara in southern Tanzania.Mosquitoes which had fed during the night werecollected in the morning by resting collectionsfrom inside houses. A total of 409 mosquitoeswere collected of which 149 (36%) were A. gambiaes.l. and 260 (64%) were A.funestus. The mosquitoeswere placed in paper cups covered with nets, andkept for seven days in an insectary to allow oocyststo develop then dissected. The mosquito midgutswere examined for oocysts using the threemethods. For each method, the examination wascarried out by a different trained worker. Thestudy design was such that neither of the examinersusing the saline, merbromin and PCR tests knewthe other's findings.RESULTS AND DISCUSSIONIn the preliminary survey on 20 laboratory-bredmosquitoes, all three assays showed 100%specificity. Of the 97 infected wild-caughtmosquitoes, the saline test detected oocysts in 94of them. The merbromin and PCR test detectedhttps:/www.cambridge.org/core/terms. https://doi.org/10.1017/S1742758400007748Downloaded from https:/www.cambridge.org/core. University of Basel Library, on 30 May 2017 at 14:06:10, subject to the Cambridge Core terms of use, available atExamination for plasmodium oocysts in mosquito midguts 115Table 1. Numbers of mosquitoes with and withoutoocysts identified by three different methodsnamely phosphate buffered saline microscopy(saline test), merbromine stain microscopyTable 2. Frequency distribution of oocysts inmidguts of mosquitoes dissected and examinedby merbromin testFrequency(PCR)ResultsPositivesA. gambiae s.l.A.funestusNegativesA. gambiae s.l.A. funestusSaline3460115200MethodsMerbromin3562114198PCR3562114198No. ofoocystsper gut11234567A. gambiae s.l.1410934333A.funestus1982218114421Total 409 409 409oocysts in all 97. Thus, the simplest of the threediagnostic tests—the saline test—missed only threepositive guts each of which had one small oocyst.The sensitivity of the saline test was therefore 97%that of PCR or merbromin tests.The frequency distribution of oocysts in theguts as obtained using the merbromin test is shownin Table 2. The number of oocysts per gut rangedfrom 1 to 7. Most of the mosquitoes (30%) had oneoocyst per gut. The distribution of the number ofoocysts per mosquito is skewed to the right, witha median of 0, geometric mean of 3.14 and SD of1.39; only 4 mosquitoes had 7 oocysts each.Recent development of advanced 'high-tech'methods has increased the potential for detectingdifferent stages of the life cycle of tropical diseaseparasites, in both humans and vectors. Bothradioactive and non-radioactive PCR andhybridisation techniques have been developedand some are already undergoing field trials(Rodgers et al., 1990; Snounou et al, 1993) for usein tropical diseases research. Other techniquesalso in use or being developed include enzyme-linked immunosorbent assay (ELISA) andimmunoflorescence assay (IFA) (Zavala et al., 1982;Githeko et al., 1992; Zimmerman et al., 1992;Tassanakajon et al., 1993). These methods arespecific, accurate and fast and although appearlikely to replace the old ones, this study suggestsotherwise.In the past, the saline test with or withoutstaining was the standard method used for thedetection of plasmodium oocysts in mosquitoes(Burkot et al., 1984).A major disadvantage of the saline microscopicmethod is that it does not distinguish the speciesof oocysts and therefore it cannot be used toTotal 149 260quantify P.falciparum infection in situations whereother Plasmodium species are present. In contrast,the PCR method used is specific for P.falciparum.In Namawala, sporozoite rates for differentPlasmodium species in wild mosquitoes have notbeen determined. In human inhabitants, however,Smith et al. (1993) reported that P. falcipanimoccurs perennially in 60-75% of the mosquitoeswhile P. malariae occurs seasonally in less than10% (Smith et al., 1993). Plasmodium malariaeinfections do not last as long as those of P.falciparum(Beier et al., 1994) and therefore even fewer than10% P. malariae sporozoites are likely to be foundin a sample of field-caught mosquitoes.In the field, where epidemiological surveys intropical parasitic disease research is done, largesamples of infected mosquitoes are often collected(Baker, 1993; Kain and Lanar, 1991). How andwhere these samples are processed should dependon the information that is needed. To determinethe presence of oocysts, microscopy, with orwithout staining, could be the method of choice.The distribution of oocysts can also be determinedmicroscopically. Transportation of samples, whichis often cumbersome and costly can thus beavoided.There is, however, information that onlymodern techniques, such as PCR, can provide. Forinstance, PCR has been used to identify speciesand strains of Plasmodium in the vector and alsospecies-specific malaria transmission (Snounou etal., 1993; Tirasophon et al., 1993). Furthermore,the PCR technique would probably be the methodof choice in surveys over large areas involvinglarge vector populations with high man-bitingindexes as in Tanzania (Smith et al., 1993), sincehttps:/www.cambridge.org/core/terms. https://doi.org/10.1017/S1742758400007748Downloaded from https:/www.cambridge.org/core. University of Basel Library, on 30 May 2017 at 14:06:10, subject to the Cambridge Core terms of use, available at116 D. EDOH and H. HAJIconventional microscopic methods would be time-consuming and require many microscopes andtrained personnel. In such cases, it is worthconsidering whether the PCR technique could beset up in the study area. It has been shown inIfakara Centre in Tanzania that this is feasible.This study was not designed for costcomparison of the techniques. However, somecost estimates were made. The cost of the salinetest was a fifth of that of PCR. The expenditure forthe saline test was due entirely to labour costs;microscopists were paid a daily allowance fordissecting and examining mosquito midguts. ThePCR reagents were purchased at a discount fromPelker Elmer, Switzerland and airfreighted toTanzania at a reduced rate, without which thecosts would probably have been higher. The costof the equipment and the highly qualifiedpersonnel needed for the PCR assay have not beenconsidered here. Most developing countries cannotafford to pay for these 'high-tech' techniques owingto economic constraints. Therefore, techniquesneed to be identified that are inexpensive, practical,sensitive, easy to use and reasonably accurate. Fornow microscopic techniques appear to fit the bill.Acknowledgment—We thank J. Jupitfer and hisgroup for processing the samples, DerekCharlwood for advice, Helen Guyatt and JenniferJenkins for commenting on the manuscript. Wealso thank Professors M. Tanner and W. L. Kilamafor their support. This research was funded bygrants from the Friedrich Miescher-Institut, Ciba-Geigy Jubilaums Stiftung, the Swiss Directoratefor Technical Cooperation and Humanitarian Aid(SDC), the Dutch government, and the WHOImmunology Research and Training Centre (IRTC)Geneva. Research clearance was granted by theTanzanian Commission for Science andTechnology (UTAFITI) as per ref NSR/RCA 90.REFERENCESBabiker H. A., Ranford-Cartwright L. C, Currie D.,Charlwood J. D., Billingsley P., Teuscher T. andWalliker D. (1994) Random mating in a naturalpopulation of the malaria parasite Plasmoditimfalcipamm. Parasitol. 109, 413-421.Baker R. H. Jr (1993) Use of PCR in the field. Parasitol.Today 10,117-119. ;Baker R. H., Banchongaksorn T., Courval J. M.,Suwonkerd W., Rimwungtragoon K., Srittong N.and Wirth D. F. (1994) DNA probes as epidemiologictools for surveillance of Plasmoditim falcipammmalaria in Thailand. Int. }. Epidemiol. 23,161-168.Beier J. C, Oster C. N., Onyango F. K., Bales J. D.,Sherwood J. A., Perkins P. V., Chumo D. K., KoechD. V., Whitmire R. E., Roberts C. R. and Diggs C. R.(1994) Plasmodium falcipamm incidence relative toentomological inoculation rates at a site proposedfor testing malaria vaccines in western Kenya. Am.}. Trop. Med. Hijg. 50, 529-536.Burkot T. R., Zavala Fv Gwadz R. W., Collins F. W.,Nussenzweig R. S. and Roberts D. R. (1984)Identification of malaria infected mosquitoes by atwo-site enzyme-linked immunosorbent assay. Am.J. Trop. Med. Hyg. 33, 227-231.Edoh D. (1995) Rejoinder: The use of PCR in the field.Parasitol. Today 11, 68.Githeko A. K., Brandling-Bennett A. D., Beier M., AtieliF., Owaga M. and Collins F. W. (1992) The reservoirof Plasmodium falcipamm in a holoendemic area ofwestern Kenya. Traits. R. Soc. Trop. Med. Hyg. 86,355-358.Kain K. C. and Lanar D. E. (1991) Determination ofgenetic variation within Plasmodium falcipamm byusing enzymatically amplified DNA from filterpaper disks impregnated with whole blood. /. Clin.Microbiol. 26,1171-1174.Ranford-Cartwright L. C, Balfe P., Carter R. andWalliker D. (1991) Genetic hybrids of Plasmodiumidentified by amplification of genomic DNA fromsingle oocysts. Mol. Biochem. Parasitol. 49, 239-244.Ranford-Cartwright L. C, Balfe P., Carter R. andWalliker D. (1993) Frequency of cross-fertilizationin thehuman malaria parasite Plasmodium falcipamm.Parasitol. 107,11-18.Rodgers M. R., Popper S. J. and Wirth D. F. (1990)Amplification of kinetoplast DNA as a tool in thedetection and diagnosis of Leishmania.Exp. Parasitol.71, 267-275.Smith T., Charlwood J. D., Kihonda J., Mwankuyse S.,Billingsley P., Meuwissen J., Lyimo E., Takken W.,Teuscher T. and Tanner T. (1993) Absence of seasonalvariation in malaria parasitaemia in an area ofintense seasonal transmission. Acta Tropica 54, 55-57.Snounou G., Pinheiro L., Goncalves L., Fonseca L., DiasF., Brown K. N. and doRosario V. E. (1993) Theimportance of sensitive detection of malariaparasites in the human and mosquito hosts inepidemiological studies, as shown by the analysisof field samples from Guinea Bissau. Trans. R. SocTrop. Med. Hyg. 87, 649-653.Tassanakajon A., Boonsaeng V., Wilairat P. and PanyimS. (1993) Polymerase chain reaction detectionof Plasmodium falcipamm in mosquitoes. Trans. R.Soc. Trop. Med. Hyg. 87, 273-275.Tirasophon W., Tassanakajon A., Boonsaeng V., PanyimS. and Wilairat P. (1993) Sensitive detection ofPlasmodium falcipamm in blood and mosquito byDNA amplification. Trans. R. Soc. Trop. Med. Hyg.35, 117-120.https:/www.cambridge.org/core/terms. https://doi.org/10.1017/S1742758400007748Downloaded from https:/www.cambridge.org/core. University of Basel Library, on 30 May 2017 at 14:06:10, subject to the Cambridge Core terms of use, available atExamination for plasmodium oocysts in mosquito midguts 117VaughanJ.,NodenB.H. and BeierJ.C. (1994)Sporogonic malaria parasite in infected mosquitoes. Nature299,development of cultured Plasruodiinu falciparum in 737-738.six species of laboratory-reared Anopheles Zimmerman P. A., Dadzie R. Y., De Sole G., Rema }.,mosquitoes. Am. f. Trap. Mcd. Hyg. 51, 233-243. Soumbey E. and Unnasch T. R.(1992) OnchocercaZavala F., Gwadz R. W., Collins F. H., Nussenzweig R. volvulus DNA probes classification correlates withS.and NussenzweigV.(1982)Monoclonalantibodies epidemiological patterns of blindness. /. Infect.to circumsporozoite proteins identify the species of Diseases 165, 964-968.https:/www.cambridge.org/core/terms. https://doi.org/10.1017/S1742758400007748Downloaded from https:/www.cambridge.org/core. University of Basel Library, on 30 May 2017 at 14:06:10, subject to the Cambridge Core terms of use, available at

Comparison of three methods for detection of Plasmodium oocysts in wild-caught mosquitoes

Abstract

Similar works

Full text

Available Versions

RERO DOC Digital Library