Benelli, Chantal

Desguerre, Isabelle

Fouque, Françoise

Haenggell, Charles

Liebaers, Inge

Lissens, Willy

Marsac, Cécile

Meirleir, Linda De

Ponsot, Gérard

Seneca, Sara

RERO DOC Digital Library

© 7995 Oxford University Press Human Molecular Genetics, 1995, Vol. 4, No. 2 307-308Pyruvate dehydrogenase deficiency in a female due to a 4 base pairdeletion in exon 10 of the E1a geneWilly Llssens*, Isabella Desguerre1, Chantal Benelli2, Cecile Marsac3, Francoise Fouque2, Charles Haenggell4, GerardPonsot1, Sara Seneca, Inge Liebaers and Linda De MeirlelrDepartment of Medical Genetics, University Hospital, Vrije Universiteit Brussel, Laarbeeklaan 101, 1090 Brussels, Belgium, 'Department ofNeuropediatrics, HOpital Saint Vincent de Paul, ^INSERM U30, Hopital Necker and 3INSERM U75, Faculte Necker, 75015 Paris, France and4Department of Pediatrics, H6pital Cantonal Universitaire, Geneva, SwitzerlandReceived October 17, 1994, Revised and Accepted November 18, 1994The pyruvate dehydrogenase complex (PDHc) is a multiproteinsystem that links glycolysis with the TCA cycle by oxidativedecarboxylation of pyruvate to acetyl-CoA. It consists of threecatalytic enzymes (El, E2 and E3), a protein with an as yetunknown function (protein X) and two regulatory enzymes(PDH phosphatase and PDH kinase) monitoring the activation/inactivation of the complex by dephosphorylation/phosphorylation of the El component (1).PDHc deficiencies have been associated with a widespectrum of clinical presentations ranging from mildintermittent ataxia to severe neonatal lactic acidosis and earlydeath (1-3). Although almost equal numbers of male andfemale patients with a PDHc deficiency have been described,most of the molecular defects have been localised in the X-linked El a component of El (4).We report on a 18-month-old dysmorphic female with a 4base pair (bp) deletion in exon 10 of the Ela gene on one ofher X-chromosomes. She presented with a severe metabolicacidosis: lactate and pyruvate concentrations in blood were5.5 mM and 0.43 mM (UP ratio 13:1), respectively, and 6.7raM and 0.80 mM in cerebrospinal fluid (UP ratio 8:1). Shehad complete agenesis of the corpus callosum, cortical atrophy,microgyria and was micro- and hydrocephalic. She developedearly onset quadriplegia and myoclonic epilepsy. PDHc activitywas measured in mononuclear cells, fibroblasts and musclemitochondria and was 19%, 31% and 17%, respectively, ofnormal control values (5). Oxidation of pyruvate by intactmitochondria isolated from the patient's muscle was found tobe very low (45%) compared to control values. In contrast,glutamate and succinate were normally oxidized. All musclerespiratory complexes, measured by spectrophotometry, werefound to be normal. Western blot analysis of the patient'scultured fibroblasts showed normal PDH subunitimmunoreactivity (data not shown). The whole coding regionof the E l a gene was studied by SSCP analysis of sixoverlapping PCR fragments (W.Lissens et al., submitted) andshowed one abnormally migrating fragment. This fragment of248 bp, defined by primers PDS3 (AGTGGATGGAA-TGGATATCC; cDNA nucleotide positions 864-883 (4)) andPDS4 (TTTAGTTCTTCCACACTGGC; cDNA nucleotidepositions 1112-1093), and spanning exon 8, exon 9 and partof exon 10, was reamplified by PCR and directly sequencedin both directions. A mutation was localised close to primerPDS4 in exon 10, and for confirmation, exon 10 was reamplifiedfrom genomic muscle DNA using intron 9 primer PDH 10(TTTCATCACGCCGTCCTTGC) and intron 10 primer PDH70(AACTTTTAAAGCCAACCTTC). Part of the sequence ofthis 226 bp fragment at the position of the mutation is shownin Figure 1. A normal Ela sequence was found in eitherdirection, but starting from T at nucleotide position 1041 asecond sequence was superimposed on the normal one. Closeinspection indicated that the second sequence is an out ofphase E l a sequence lacking 4 bp from nucleotides AAGTAAGat cDNA positions 1038-1044, resulting in AAG. Due to thedirect repeat AAG around the central T, it was not possible todetermine the exact position of the deletion since the removalPDH 10 PDhj 70A C G T f G _C_ AFigure 1. Direct sequence analysis of PCR-amplified exon 10 of the E l agene of the patient in sense (primer PDH 10) and antisense (primer PDH70)direction, using the Sequenase kit version 2.0 (USB). The arrows indicate thestart of the superposition of a 4 bp deleted sequence on the normal one. TheT at this position corresponds to bp 1041 in the normal E l a cDNA.•To whom correspondence should be addressed308 Human Molecular Genetics, 1995, Vol. 4, No. 2of four consecutive bases from this sequence will always resultin AAG.Our patient is thus a heterozygous carrier of a normal anda 4 bp deleted El a gene. Inspection of the SSCP and cDNAsequencing gels indicated that in muscle the two alleles areexpressed at a 35%/65% proportion (data not shown). The 4bp deletion predicts a reading frame shift in the El apolypeptide after amino acid 311 and a premature stop codonat position 324. The mutation was not found in the mother'sgenomic white blood cell DNA by sequencing of the PDHIO/PDH70 PCR fragment. The father was not available for study.In our patient, the 4 bp deletion is found in a 9 bp 2 bpoverlapping, direct repeat sequence (QAAGTAAG.AAGTA-AGA; underline: start of each 9 bp repeat; the T in boldcorresponds to nucleotide position 1041), in which four AAGrepeats are present. In a study by Krawczak and Cooper (6)of small gene deletions in human genetic disease, direct repeatsare a common feature of all but one of 60 deletions analysed.Their results also indicate that small deletions are morecompatible with a model of mutagenesis based on slippingmispairing during replication than with recombination or repairof DNA. The 4 bp deletion in our patient could easily beexplained by the modified slipped mispairing hypothesis theypropose: during replication, slipping mispairing of the fourthAAG repeat with the second one on the complementary strand,with looping out and excision of the AAGT sequence inbetween, would result in two daughter duplexes, one of whichlacks the third AAG repeat and the T between repeats 3 and4. Two alternative slipped mispairing structures could alsoexplain the excision of 4 bp from the AAGTAAG sequence,but would be less stable than the former one since homologyof only two bases (looping of AGTA) or one base (looping ofGTAA) would be involved in loop formation. The fourthpossibility, deletion of TAAG, could not be explained by thishypothesis. We therefore propose to refer to the mutation inour patient as 1038del4 (7). It is also noteworthy to mentionthat the 9 bp repeat sequence contains, albeit in oppositeorientation, a 6 bp sequence (AGAAGT; cDNA nucleotidepositions 1036-1041) that perfectly matches with a consensussequence recognised as a hotspot for deletion (6). So far, threeother females have been described with small deletions in the9 bp repeat (8-10) and all of these, including our patient, havea 'cerebral' form of PDH deficiency (11,12).10.12.and Robinson,B.H. (1992) Mutations and polymorphisms in the pyruvatedehydrogenase E l a gene. Hum. Mural. 1, 97-102.Bonne.G., Benelli.C, De Meirleir.L., Lissens.W., Chaussain,M., Diryjvl.,ClotJ.-P., Ponsot,G., Geoffrey,V., LerouxJ.-P. and Marsac.C. (1993) Elpyruvate dehydrogenase deficiency in a child with motor neuropathy.Pediatr. Res. 33, 284-288.Krawczak,M. and Cooper.D.N. (1991) Gene deletions causing humangenetic disease: mechanisms of mutagenesis and the role of the localDNA sequence environment Hum. Genet. 86, 425-441.Beaudet,A.L. and Tsui,L.-C. (1993) A suggested nomenclature fordesignating mutations. Hum. Mutat. 2, 245-248.Dahl,H.-H.M., Maragos.C, Brown.R.M., Hansen.L.L. and Brown,G.K.(1990) Pyruvate dehydrogenase deficiency caused by deletion of a 7-bprepeat sequence in the E la gene. Am. J. Hum. Genet. 47, 286-293.HansenXX., Brown.G.K., Kirby.D.M. and Dahl,H.-H.M. (1991)Characterization of the mutations in three patients with pyruvatedehydrogenase E l a deficiency. J. lnher. Metab. Dis. 14, 140-151.Chun.K., MacKayJM., Petrova-Benedict,R. and Robinson3-H. (1993)Mutations in the X-linked E l a subunit of pyruvate dehydrogenase leadingto deficiency of the pyruvate dehydrogenase complex. Hum. Mol. Genet.2, 449-454.Chow.C.W., Anderson.R.C. and Kenny.G.C. (1987) Neuropathology incerebral lactic acidosis. Acta Neurvpathol. 74, 393-396.Brown.G.K., Haan.E.A., Kirby.D.M., Scholem.R.D., WraithJ.E.,RogersJ.G. and Danks.D.M. (1988) 'Cerebral' lactic acidosis: defects inpyruvate metabolism with profound brain damage and minimal systemicacidosis. Eur. J. Pediatr. 147, 10-14.ACKNOWLEDGMENTSWe would like to thank Mrs A.Delecoeuillerie for excellent technical assistanceand Mrs M.C.Decreton and Mr E.Van Emelen for help in the preparation ofthe manuscript. This work was supported by grants from the National Fundfor Scientific Research (Belgium, grant number 3.0065.87) and the ResearchCouncil of the Vrije Universiteit Brussel.REFERENCES1. Robinson,B.H. (1993) Lacticacidemia. Biochim. Biophys. Acta 1182,231-244.2. Brown.G.K., Brown,R.M., ScholenvR.D., Kirby.D.M. and Dahl.H.-H.M.(1989) The clinical and biochemical spectrum of human pyruvatedehydrogenase deficiency. Ann. NY AcatL Sri. 573, 360-368.3. Robinson.B.H., MacMillan.H., Petrova-BenedicuR., Sherwood,W.G.(1987) Variable clinical presentation in patients with deficiency of pyruvatedehydrogenase complex. A review of 30 cases with a defect in the E l acomponent of the complex. J. Pediatr. Il l , 525—533.4. Dahl,H.-H.M., Brown.G.K., Brown,R.M., HansenJLL., Kerr.D.S.,WexlerXD., PatelJvl.S., De Meirleir.L., Lissens,W., Chun.K., MacKay^J.

Pyruvate dehydrogenase deficiency in a female due to a 4 base pair deletion in exon 10 of the E1α gene

Pyruvate dehydrogenase deficiency in a female due to a 4 base pair deletion in exon 10 of the E1α gene

Abstract

Similar works

Full text

Available Versions

RERO DOC Digital Library