Civelli, O.

Grandy, D.K.

Zhang, Y.

RERO DOC Digital Library

Human Molecular Genetics, 1993, Vol. 2, No. 12 2197Polymorphism in the humandopamine D4 receptor gene(DRD4) in Japanese detected byPCRAkira Inoue1,*, Hiroshi lhara1-2, Taizaburo Kon1,Michiko Nakamura3, Jiro Suzuki3, Tsugutoshi Aoki2,Hiromichi Hemmi1 and Hiroyuki Shimatake1'Department of Molecular Biology, 2Department of Laboratory Medicine, OhashiHospital and 3Department of Neuropsychiatry, Toho University School ofMedicine, Tokyo, JapanDescription: There has been reported the polymorphismcontaining two- to eight-fold repeats of 48-base-pair sequencein the putative third cytoplasmic loop region of dopamine D4receptor gene (1,2). Such variation among humans may underlieindividual differences in susceptibility to neuropsychiatric diseaseand in responsiveness to antipsychotic medication (1). In thisreport, we show the detection of the polymorphism amongJapanese population by PCR.Primer Sequences:Forward: 5' ccgcggcctgcagcgctggg 3'.Reverse: 5' gcgcggcggctctgacggcg 3'.PCR products were separated in a 5% polyacrylamide gel.Frequency: Allele frequency was determined from genomic DNAof 52 unrelated healthy Japanese individuals. The observedheterozygosity was 0.38.AlleleClC2C3C4C5bp410362314266218Number1581116Frequency.01.05.78.01.15Chromosome Assignment: l i p 15.5 (3).Mendelian Inheritance: Co-dominant Mendelian inheritance wasobserved in 4 unrelated families (18 individuals).PCR Conditions: One fig genomic DNA, 50 pmole of eachdeoxynucleotide, 200 mM dNTPs and 5 units Vent (exo~) DNApolymerase (New England Biolabs), lxVent buffer (10 mMKC1, 20 mM Tris-HCl (pH 8.8), 0.01% Triton X-100) and 2mM MgSO4 in a total volume of 100 /tl. Fifteen cycles of 99°Cfor 1 minute and 79 °C for 2 minutes followed by 15 cycles of99°C for 1 minute and 75°C for 2 minutes and finally extensionat 75°C for 10 minutes. Both forward and reverse sequences ofPCR products of 10 individuals selected randomly weredetermined by direct sequencing with small modifications (4).Acknowledgements: This study was supported by the Grant-inAid for Scientific Research of the Ministry of Education, Scienceand Culture of Japan.References: 1) Van Tol.H.H.M. et al. (1992) Nature 358,149-152. 2) O'Dowd.B.F. (1992) Gene 118, 310-302. 3)Gelernter et al. (1991) Cytogenetics and Cell Genetics 58, 1960.4) Hultmann.T. et al. (1991) Biotechniques 10, 84-93.PCR detection of the TaqA RFLPat the DRD2 locusD.K.Grandy1A*, Y.Zhang1 and O.Civelli1-3Departments of 'Cel Btology and Anatomy and the fo l ium Institute, OregonHealth Sciences University, Portland, OR 97201, USA and 3F Hoffmann-LaRoche,Inc, Basel, SwitzerlandDescription, Source and Method: The genomic clone XHD2G1contains the last coding exon of the human dopamine D2 receptorand approximately 15-kb of 3' flanking sequence (1). This phageidentifies a TaqI RFLP (2). One allele, TaqAl, has been reportedto be associated with severe forms of alcoholism (3) and drugabuse (4). As an alternative to Southern blotting we havedeveloped a rapid PCR method for typing individuals with respectto the TaqA RFLP.XHD2G1 was partially mapped with restriction enzymes andthe polymorphic TaqI site was localized to a 5 kb BamHIfragment 3' of the D2 receptor coding region (5). This fragmentwas subcloned, digested with TaqI and partial nucleotide sequencefrom these ends was determined. Based on this sequence a pairof oligonucleotide primers were synthesized and used in a PCRto amplify a 310 bp region (GenBank accesssion no. L22303)surrounding the TaqA site.PCR Primers:971: 5'-CCGTCGACGGCTGGCCAAGTTGTCTA-3'5014: 5'-CCGTCGACCCTTCCTGAGTGTCATCA-3'Variation: When the 310 bp PCR product is incubated with TaqIthe Al allele remains intact while the A2 allele is cut into a 130bp piece and a 180 bp piece. All three fragments are resolvedon a 1% agarose gel and can be visualized by staining withethidium bromide. In addition to these three bands a faint bandof about 650 bp is also seen in among the PCR products. Thisband is not cut by TaqI and does not interfere with the analysis.Al = 310 bpA2 = 130, 180 bpChromosomal Localization: The phage XHD2G1 was used to mapthe dopamine D2 receptor gene locus (DRD2) to chromosomeIlq22- l lq23 (2).Mendelian Inheritance: The TaqA RFLP is inherited in aMendelian fashion (2).PCR Conditions: Performed according to standard conditions;94°C 1 min, 50°C 1 min, 92°C 1.5 min for 35 cycles. Digestionof 10 /tl of the PCR products was accomplished overnight with5 units of TaqI under oil at 65°C.Acknowledgements: This work was supported by The AmericanParkinson's Disease Association and NIMH (MH48915).References: 1) Grandy.D. et al. (1989) Proc. Nail. Acad. Sci.USA 86, 9762-9766. 2) Grandy.D. etal. (1989) Am. J. Hum.Genet. 45, 778-785. 3) Blum et al. (1990) J. Am. Med. Assoc.263, 2055-2060. 4) Comings.D.E. etal. (1991) J. Am. Med.Assoc. 266, 1793-1800. 5) Hauge et al. (1991) Genomics 10,527-530.* To whom correspondence should be addressed ; To whom correspondence should be addressed

PCR detection of the TaqA RFLP at the DRD2 locus

Abstract

Similar works

Full text

Available Versions

RERO DOC Digital Library