To obtain tools for the estimation of inbreeding and assignment of offspring to matrilines, we developed 13 microsatellite loci from the fig wasps that pollinate Ficus obtusifolia. Based on morphological studies, it was thought that a single species (Pegoscapus hoffmeyer) pollinated this fig. However, our data revealed the presence of two coexisting cryptic species. Several diagnostic microsatellite markers may be used to distinguish these two cryptic species. The new microsatellites can be used across a wide range of fig-pollinating wasp species for both evolutionary and population genetic studies

D. Molbo

E. A. Herre

Frank SA

Hamilton WD

Herre EA

L. Keller

Lincoln SE

M. J. B. Krieger

Molbo D

Nei M

Rassman K

Wiebes JT

Molbo, D.

Krieger, M. J. B.

Herre, E. A.

Keller, L.

UNIL IRIS | Institutional Research Information System

Molecular Ecology Notes

Species-diagnostic microsatellite loci for the fig wasp genus Pegoscapus

Serveur académique lausannois

 Molecular Ecology Notes (2002)  2 , 440—442 doi: 10.1046/j.1471-8278 .2002.00268.x' 2002 Blackwell Science Ltd Blackwell Science, Ltd PRIMER NOTE Species-diagnostic microsatellite loci for the fig wasp genus  Pegoscapus D .  MOLBO,*à M.  J .  B .  KRIEGER,*  E .  A .  HERREà and L .  KELLER** Institute of Ecology, University of Lausanne, 1015 Lausanne, Switzerland,    Department of Entomology, University of Georgia, Athens, GA 30602—2603, USA,  à Smithsonian Tropical Research Institute, Apartado 2072, Balboa, Republic of Panama  AbstractTo obtain tools for the estimation of inbreeding and assignment of offspring to matrilines,we developed 13 microsatellite loci from the fig wasps that pollinate  Ficus obtusifolia .Based on morphological studies, it was thought that a single species ( Pegoscapus hoffmeyeri )pollinated this fig. However, our data revealed the presence of two coexisting crypticspecies. Several diagnostic microsatellite markers may be used to distinguish these twocryptic species. The new microsatellites can be used across a wide range of fig-pollinatingwasp species for both evolutionary and population genetic studies. Keywords : cross-species amplification, cryptic species, fig wasp, microsatellites,  Pegoscapus , primers  Received 26 April 2002; revision received 29 May 2002; accepted 29 May 2002 Fig-pollinating wasps have been used as model organismsto study evolution of mutualism (Machado  et al . 2001) andsex ratio theory (Hamilton 1967; Frank 1985; Herre 1985).Among these, the theory of local mate competition (LMC)has been considered Ôthe section of evolutionary theorythat best proves the power and accuracy of the Neodar-winian paradigm as a wholeÕ (Hamilton 1996). In spite oftheir importance, most of the assumptions about matingstructure on which previous tests of LMC were basedhave never been tested (Herre  et al . 2001). Genetic markerswould allow the testing of these by enabling estimationof inbreeding coefficients and observation of the repro-ductive behaviour (sex ratios and brood size) of individualfoundresses (Molbo & Parker 1996). Here we report thefirst microsatellite markers developed for fig wasps.Primers were developed using modifications of proto-cols described by Rassman  et al . (1991). Genomic DNA wasextracted from approximately 800  Pegoscapus hoffmeyeri wasps (Wiebes 1995) collected from several Panamanian Ficus obtusifolia  trees. Wasps were used only from figs with-out wasp-parasitizing nematodes or mites. Total genomicDNA was extracted with phenol—chlorophorm anddigested with the restriction enzymes  Alu I,  Hae III and  Rsa Iaccording to the manufacturerÕs protocols. Ten  m g of 200—600 bp DNA fragments were ligated into pBluescript¤ IIKS (+) vectors (Stratagene) to transform Epicurean coli¤XL1-Blue MRF ¢  supercompetent bacteria (Stratagene).Approximately 6000 clones were screened by hybridiza-tion with three oligonucleotides (TC 10 , TG 10 , AAT 10 )labelled with the DIG system (Boehringer Mannheim)using the manufacturerÕs directions. To verify microsatel-lite presence and locate them within the insertion, 112recombinant clones were polymerase chain reaction (PCR)screened with all combinations of oligonucleotides andflanking primers (T3 and T7). Twenty-five positive cloneswere sequenced on an ABI377 automated sequencer byMicrosynth GmbH, Switzerland. Primers flanking repeatsequences were designed for 20 loci using Primer 1.0(Lincoln  et al . 1993). Thirteen of these amplified satisfactorily(Table 1).DNA was extracted from single wasps using the Pure-gene¤ DNA isolation kit (Gentra) modifying the manu-facturerÕs single  Drosophila melanogaster  protocol as follows:individual wasps were homogenized using liquid nitro-gen, then 100  m L cell lysis solution (Gentra) and 0.01  m gProteinase K were added and samples were incubatedat 55  ° C overnight. Protein and DNA were precipitatedaccording to GentraÕs protocols, and the DNA was redis-solved in 50  m L DNA hydration solution and stored at - 20  ° C. One  m L extraction was used per PCR reaction.PCR reactions were set up in 10- m L volumes containing1  ·  PCR buffer (Quiagen), 0.5  m m  of each primer, 0.1 m m  of Correspondence: Drude Molbo, IE-ZEA, Batiment de Biologie,Universit de Lausanne, 1015 Lausanne, Switzerland. Fax: (+ 41)216924165; E-mail: drude.molbo@ie-zea.unil.ch MEN_268.fm  Page 440  Tuesday, November 12, 2002  10:18 PM PRIMER NOTE 441 ' 2002 Blackwell Science Ltd,  Molecular Ecology Notes , 2, 440—442 Table 1 Characteristics of microsatellite loci for  Pegoscapus  fig wasps      LocusPrimer sequenceF = forward primerR = reverse primer T a ( ° C)MgCl 2 mM Repeat motifGenBankaccession no.Product length ranges bp(numbers of observed alleles) P. hoffmeyeri  sp.  An  = 40 P. hoffmeyeri sp.  Bn  = 25 Cross-species amplificationPe 3 F:  GCTAATTCCCCCAACTCACA 55 1.88 ( GA ) 5 AA (  GA  )  3  AF491966 143 (1) 141 (1) 4A, 4B, 5, 14, 15A, 15C, 17BR:  GCCTTGGCCAATGATCAC  Pe 9 F:  AGATCCGAAAGCGACACG  55 1.88 (  GA  )  19  AF491967 100—132 10 108 (1) 3, 5*, 7, 14, 17A*R:  CCGCGCTAGAAACATCTCTC  Pe 28 F:  ACGGGTGAAACCTCGATTC  55 1.88 ( GA ) 9 AF491968 143—149 (4) 145 (1) 3*, 4A, 4B, 5, 15A, 15C, 17BR:  CCCTGCATCCATTCTCTCTC Pe 45 F:  CGAGACAATTTCCTTCTCGTG  55 1.88 ( GA ) 6 AF491969 145 (1) 141 (1) 3*, 4A, 4B, 5*, 7, 14, 15A, 15C, 17AR:  ACCTGCGCGACTTACTTTTC Pe 51 F:  ACGACGGAGAGAGAGAAAGAG 55 1.88 ( GA ) 5 AA ( GA ) 2 AA ( GA ) 8 AF491970 114 (1) Ñ 4A*, 14*, 15A*, 15C, 17A*, 17B*R:  CCGATTCACACCCACACTC Pe 52 F:  CAACTCACTTGCAACAAAGAAA 55 1.88 ( TC ) 7 (N) 42 ( CGTG ) 4 CG AF491971 149 (1) 145 (1) 3, 4A, 4B, 6, 14, 15A, 15C, 17A, 17BR:  GTAACGCATCAAGAGGAAAAGG Pe 77 F:  AAACCTGCTGTTGCCGAG 55 1.88 ( TC ) 8 AF491972 114 (1) 116 (1) 3, 4A, 4B, 5, 6, 7*, 14, 15A, 15C, 17A, 17BR:  ACTCCTTGTCCATCTGTTGACA Pe 84 F:  GTTACCGTATAACAACCCTCGC 55 2.5 ( AC ) 10   AT ( AC ) 13   A AF491973 111—115 (3) 133—137 (3) 4A, 4B, 6, 14*, 15A, 15C*, 17AR:  TCTCCATCTACCCCGTTGAC Pe 91 F:  AATATAGTGCCAATCCAGTGGG 55 1.88 ( GA ) 12 AF491974 82 (1) 78 (1) 4A, 4B*, 5, 14, 15A, 15C, 17BR:  AATTACCGAGTTGTGCAGGC Pe 99 F:  ACGGAATCGAAAATGCATTC 54 1.88 ( CT ) 5 (N) 125 ( TC ) 14 AF491975 230—242 (6) 220—222 (2) 3, 4A, 4B, 5, 6, 7, 14, 15A, 15C, 17A, 17BR:  CATAAAATCTTGTGCTACCGTG Pe 103 F:  ACGCTTAAATTTTACAACGCG 55 2.5 ( TAA ) 10 AF491976 131—152 (4) 122 3*, 5, 6, 7*, 14, 15C*, 17AR:  TTTTACCGCGTTTGAATGTG Pe 107 F:  CCTTACCGTAAAAATCTCGACG 55 1.88 ( GA ) 4 GC ( GA ) 4 GC ( GA ) 3 AF491977 212 (1) 202 (1) 3*, 4A, 4B, 5*, 7, 14, 15A, 15C, 17A, 17BR:  CTTCATAAAGTAGCGCGTTGG Pe 109 F:  TATCGGAAATGGAAGGCAAC 54 1.88 ( TG ) 5 T AF491978 105 (1) 105 (1) 4A, 4B, 5, 6*, 14*, 15A, 15C, 17A, 17BR:  AGCATGAAAATGTGATCGAGG T a , annealing temperature; MgCl 2 , the concentration of MgCl 2  in PCR reactions;  n , numbers of individuals that had allele length ranges characterized in two cryptic  Pegoscapus  species from  F. obtusifolia . Cross-species amplification was recorded for the  Pegoscapus  species  P. tonduzi  (3),  P. gememllus  sp. A collected from  Ficus popenoei  (4A),  P. gemellus  sp. B (4B),  P. piceipes  (5),  P. grandii  (6),  P. lopesi  (7), P. silvestrii (14), P. gemellus sp. A collected from F. bullenei (15A) P. gemellus sp. C (15C), P. insularis sp. A (17A), P. insularis sp. B (17B); * following a species number indicates the PCR products were faint but could be scored.MEN_268.fm  Page 441  Tuesday, November 12, 2002  10:18 PM442 P R I M E R  N O T E' 2002 Blackwell Science Ltd, Molecular Ecology Notes, 2, 440—442each of dCTP, dGTP and dTTP and 0.02 mm dATP,1.88—2.5 mm MgCl2 (see Table 1) and 0.02 m L 33P-dATP and0.31 U Taq polymerase (Quiagen). The cycling programwas 4 min at 94 ° C, then 30 cycles of (92 ° C, 30 s; annealingtemperature (see Table 1), 30 s; and 72 ° C, 1 min). Thermalcyclers used were PTC-100 Programmable Thermal Con-troller (MJ Research, Inc.) and GeneAmp¤ PCR System9700 (Applied Biosystems).An analysis of the genotypes of female (diploid) figwasps collected from F. obtusifolia revealed the presence oftwo cryptic species (P. hoffmeyeri sp. A and P. hoffmeyeri sp.B). Ten of the 13 loci were species diagnostic (Table 1). Nineof the diagnostic loci had nonoverlapping allele ranges andone locus amplified DNA only from P. hoffmeyeri sp. A(Table 1). Two of the three nondiagnostic loci (Pe 9 and Pe28) had a single fixed allele in P. hoffmeyeri sp. B that wasincluded in the allele length range in P. hoffmeyeri sp. A(Table 1). The last nondiagnostic locus (Pe 109) was fixedfor the same allele in both species (Table 1). We includeinformation on this locus because cross-species ampli-fications (Table 1) showed that it was polymorphic inP. piceipes (three alleles 116—120 bp), diagnostic for twocryptic P. gemellus spp. (107 vs. 108 bp) and two P. insularisspp. (105 vs. 109 bp).Two lines of evidence suggest that gene flow is absent orvery restricted between P. hoffmeyeri sp. A and P. hoffmeyerisp. B. First, we observed only four hybrids among the 431females (one per fruit) genotyped. Second, the four hybridswere F1 and no back-cross (F2) genotypes were observed,suggesting that hybrid fitness is severely reduced.The observed heterozygosity (Table 2) was extraordinar-ily low, in accordance with the known breeding structureof fig wasps. Interestingly, we found that inbreeding washigher than previously estimated by nonmolecularmethods (Molbo et al. in prep). This is not surprising, giventhat earlier estimates of inbreeding were based erroneouslyon the assumption that there was only one fig waspspecies.Screening across species revealed that other fig treesmay commonly be pollinated by several cryptic species.The 13 loci were variable and/or diagnostic for crypticspecies among pollinators from seven other Ficus speciesstudied (Table 1, Molbo et al. in prep). These microsatellitemarkers are currently the only way to distinguish thecryptic Pegoscapus species. They provide a useful diagnostictool for a wide range of both evolutionary and populationgenetic studies in fig wasps of the genus Pegoscapus (Molboet al. submitted).AcknowledgementsFunding was provided by the Smithsonian Tropical ResearchInstitute and Augustinus fondet to DM, and several grants fromthe Swiss NSF to LK.ReferencesFrank SA (1985) Hierarchical selection theory and sex ratios II. Onapplying the theory, and a test with fig wasps. Evolution, 39,949—964.Hamilton WD (1967) Extraordinary sex ratios. Science, 156, 477—488.Hamilton WD (1996) Narrow Roads of Geneland I, Evolution of SocialBehaviour. Freeman, Oxford, UK.Herre EA (1985) Sex Ratio Adjustment in Fig Wasps. Science, 228,896—898.Herre EA, Machado CA, West SA (2001) Selective regime and figwasp sex ratios: towards sorting rigor from pseudo-rigor in testsof adaptation. In: Adaptationism and Optimality (eds Orzack SH,Sober E). Cambridge University Press, Cambridge, UK.Lincoln SE, Daly MJ, Lander ES (1993) Primer 1.0: A ComputerProgram for Automatically Selecting PCR Primers. MIT Center forGenome Research and Whitehead Institute for BiomedicalResearch, Cambridge, MA.Machado CA, Jousselin E, Kjellberg F, Compton SG, Herre EA(2001) Phylogenetic relationships, historical biogeographyand character evolution of fig-pollinating wasps. Proceedings ofthe Royal Society of London Ñ Series B: Biological Sciences, 268,685—694.Molbo D, Parker ED Jr (1996) Mating structure and sex ratio vari-ation in a natural population of Nasonia vitripennis. Proceedingsof the Royal Society of London Ñ Series B: Biological Sciences, 263,1703—1709.Nei M (1987) Molecular Evolutionary Genetics. Columbia UniversityPress, New York.Rassman K, Schltterer C, Tautz D (1991) Isolation of simplesequence loci for use in polymerase chain reaction-based DNAfingerprinting. Electrophoresis, 12, 113—118.Wiebes JT (1995) Agaonidae (Hymenoptera, chalcidoidea) andFicus (Moracea): fig wasps and their figs, XV (MesoamericanPegoscapus). Proceedings of the Koninklijke Nederlandse AkademieVan Wetenschappen, 98, 167—183.Table 2 Expected heterozygosity, HO (gene diversity, Nei 1987;equation 7.39, p. 164) and observed heterozygosity, HE, forselected loci in two Pegoscapus species    LocusP. hoffmeyeri sp. A P. hoffmeyeri sp. Bn HE HO n HE HOPe 9 339 0.853 0.125Pe 28 58 0.149 0.048Pe 84 338 0.204 0.041 115 0.507 0.051Pe 99 39 0.521 0.103 60 0.066 0Pe 103 40 0.316 0.055MEN_268.fm  Page 442  Tuesday, November 12, 2002  10:18 PM

Crossref

https://repository.si.edu/bitstream/handle/10088/1667/Molbo_Krieger_Herre_and_Keller.pdf

Species-diagnostic microsatellite loci for the fig wasp genus Pegoscapus

Abstract

Similar works

Full text

Available Versions

UNIL IRIS | Institutional Research Information System

Serveur académique lausannois

Crossref