Phage shock protein A (PspA) belongs to the highy conserved PspA/IM30 family and is a key component of the stress inducible Psp system in Escherichia coli. One of its central roles is the regulatory interaction with the transcriptional activator of this system, the σ54 enhancer binding protein PspF, a member of the AAA+ protein family. The PspA/F regulatory system has been intensively studied and serves as a paradigm for AAA+ enzyme regulation by trans-acting factors. However, the molecular mechanism of how exactly PspA controls the activity of PspF and hence σ54-dependent expression of the psp genes is still unclear. To approach this question, we identified the minimal PspF-interacting domain of PspA, solved its structure, determined its affinity to PspF and the dissociation kinetics, identified residues that are potentially important for PspF regulation and analyzed effects of their mutation on PspF in vivo and in vitro. Our data indicate that several characteristics of AAA+ regulation in the PspA·F complex resemble those of the AAA+ unfoldase ClpB, with both proteins being regulated by a structurally highly conserved coiled-coil domain. The convergent evolution of both regulatory domains points to a general mechanism to control AAA+ activity for divergent physiological tasks via coiled-coil domains

Brüser, T.

Grubmüller, H.

Heidrich, E.

Lilie, H.

Mehner, D.

Osadnik, H.

Parthier, C.

Risselada, H.

Schöpfel, M.

Stubbs , M.

English

MPG.PuRe

PspF-binding domain PspA1-144 and the PspA·F complex: New insights into the coiled-coil-dependent regulation of AAA+ proteins.

Supporting informationThe PspF-binding domain PspA1-144 and the PspA∙F complex - New insights into the coiled-coil dependent regulationof AAA+ proteinsOsadnik et al. (2015) containsSupporting Figures S1-S6Supporting tables S1-S2NCCNACCC1 CC2NTRcoiled-coil coreextended hydro-phobic regionBCC1 CC2N *Conservation histogram Proteobacterial PspA1000NTRCC2NTR90°DENTR Figure S1Stereoscopic view of PspA M-domain superimposition CNCNCNCNCNCNC CN NFigure S2 WTE23AD24AK27AL28AR30AL31A I33SQ34AE35AM36AE37AD38AQ136AQ136KBPspA1-144 0510152025100pspA reporter activity (normalized)empty∆pspA reporter + PspA1-144   γ-proteobacterial PspA1000100All PspA/IM30 proteinsCC1 CC2NN-terminal region (NTR) tip region NTR stabilization / FBRConservationputative PspF binding region (FBR) A012345WTK55AK55ER59AR59EpspA reporter activity (normalized)CRegions of conservation in PspA1-144  Preliminary screens for  conserved PspF-inhibiting residues in PspA1-144  PspA1-144  D24L28K27R30E37D38L31Q34I33M36K55R59Q136D Orientation of putative PspF-inhibiting residues in PspA1-144  PspA1-144  ∆pspA reporter + PspA1-144   Figure S3FT W E1 E2 E3 E4 E5 E6 E7full-lengthPspA E37APspFfull-lengthWT-PspAPspFpspA reporter activity (Miller Units) 1.35.31.42.81-2221-2221-2221-2221-1441-1441-1441-144emptyemptyemptyempty050100150200250300∆pspBWT ∆pspC ∆pspGFull-length PspA induction effect depends on PspBCWTE37AemptypspA reporter activity (Miller Units) 050100150200250300350400450PspA1-222 Effects of PspA1-222E37A in a WT reporterA Effects of PspA1-144 E37A in a WT reporterpspA reporter activity (Miller Units) 050100150200250300350400450WTE37AemptyPspA1-144  BDCEPspF concentration is comparable in all tested strainsCo-Purification of full-length PspA and its variant with PspF WTE37AR59EWTPspA1-144  PspA1-222  Figure S4154545158 9 10 11 12 13 14 15 16 17 18 19 20 21 22 1:102:108:101:11:1 + AMPPNP1:1+ATPPspF3:104:10PspF1-2651.7:1 + ATP1.7:1 + AMPPNP1.7:1 0.17:1 0.35:1 0.5:1 0.7:1 0.85:1 1:1 1.2:1 1.35:1 PspA1-144 PspF265only1.7:1 + ATP1.7:1 + AMPPNP1.7:1 0.17:1 0.35:1 0.5:1 0.7:1 0.85:1 1:1 1.2:1 1.35:1 PspA145  onlyIncreasing concentration of PspAfree PspFPspA:F complexnucleotidesA B0      2        4            6   8 100.000.050.100.150.200.05 mM ADP0.25 mM ADP1 µM PspFFraction of UV absorption (230 nm)0.5 mM ADPapp)Sedimentation coefcient (SCDfree PspAPspA (µM)0.0 0.2 0.4 0.6 0.8 1.0 2.0fraction of fast sedimenting species (%)0204060801001 µM PspFWTE37A1.8R59E2 4 6 8 10    0  0.1  0.2  0.310 µMapp)1µMPspF6PspFSedimentation coefcient (SFraction of UV absorption (230 nm)PspA·F complex formation in SEC concentration dependence of PspF self-hexamerization complex formation at low PspF concentrationeffects of nucleotides at low PspF concentration02550751000 500 1000 1500 2000 2500Phosphate [µM]Time after dilution (s)Koff (app) ≈ 2.69∙10-4 s-1Koff determination via de-repression of ATPase activity EFigure S5E37/Q136K55/R59A Atomistic simulation of PspA∙F complexesFBR facing PspFW56sensor II0 ns 138 nsstable interactionno interactionFBR pointing awayB model of the PspA∙F complex based on simulation90° Figure S6 Supplementary Figure Legends Figure S1: The N-terminal region folds back to the PspF-binding domain. Important amino acids (in a,b,c):  conserved hydrophobic amino acids that attach the NTR to CC1;  hydrophobic coiled-coil core forming residues;  laterally protruding hydrophobic amino acids from CC1 and one from CC2 ( ) that link the hydrophobic core of the coiled coil and the hydrophobic region formed by the back-folding NTR;  a residue of CC2 (Lys128) that contacts the NTR;  Asn14 and Ala17, whose backbone is contacted by Asn14. Asn14 is needed for PspC interaction, see discussion. (a) front and side view of the back-folding N-terminus.  (b) Schematic depiction of the front view in A, showing the large hydrophobic face of CC1 and the extended hydrophobic region formed by the coiled-coil core and the back-folding NTR ( ).  (c) Conservation histogram of -proteobacterial PspA (overview) and detailed excerpts showing the high overall degree of conservation of the highlighted amino acids.  (d) The N-terminal region is flexible, but stably attached to CC1 and CC2 during atomistic simulations. PspA1-144 molecules (n=19) were aligned in their NTR/CC1 region after 18 ns of simulation (avg.). Even though the rest of the protein as well as the NTR moved considerably and the NTR showed high flexibility in the region 13-24 ( ), it was still tightly attached to CC1 ( ).  (e) The less well defined electron density of the crystal structure in the N-terminal region indicates flexibility of this region as well. Cartoon representation of PspA1-144, colored according to B-factor of residues in the crystal structure, arrows as in D.  Figure S2: Stereoscopic views of superimposed backbones of ClpB-MD ( ) and PspA ( ) from the alignment shown in Fig. 3A, as described in the main text.    Figure S3: Preliminary screen to identify putative change of inhibition variants of PspA1-144.  (a) Full overview of regions of PspA1-144 drawn on top of comparative consensus profiles of -proteobacterial PspA (upper part) and PspA/IM30-family proteins (lower part) indicating regions of structurally important amino acids (i.e. conserved in both profiles) as well as amino acids putatively important for proteobacterial PspAs only (i.e., not conserved in all PspA/IM30-family proteins). Colors for structurally important amino acids in PspA/IM30 as in Fig.2. (b, c) Preliminary screen of single amino-acid variants of PspA either in the N-terminal (c) or the C-terminal (c) part of the region conserved in -proteobacteria using a long-induction LacZ-activity assay. All data normalized to repression level of the wild-type fragment. Several exchanges show markedly reduced inhibition of PspF compared to the wild-type fragment ( ), or, in the case of the R59E variant, slightly increased repression. Variants E37A and R59E were used for detailed studies of PspF inhibition. Even weaker inhibiting variants (up to 25-fold higher psp levels) still strongly inhibit PspF, as the empty vector control has a 100-fold increased psp level (panel b, empty)  (d) Orientation of variants on the PspA structure. Variants from the screen in (b) are colored depending on the strength of their effect ( - surface residues and  non-surface residues with strong loss of inhibition;  weak to no effect on inhibition). Loss of inhibition variants cluster on one face of PspA and point into the same direction as residues R59 and K55, indicating a putative PspF binding patch, see also Fig.4A.   Figure S4: Effects of PspA variants in PspF regulation in vivo (a) The PspF level in reporter strains with constitutively produced PspF is indeed comparable and not influenced by different variants. Western Blot developed against the strep-tag of PspF-strep after 3h induction (0.1% arabinose), compare to LacZ assays in Fig.4D. (b) The upregulating effect of PspA1-144-E37A also exists in the full psp wild-type background and is therefore independent of pspF overproduction. Long-term induction (compare to Fig.4D, right) leads to strong induction of psp, while the wild-type fragment shows repression of psp as before. (c) The E37A variant has the same up-regulating effect if introduced into full-length PspA (PspA1-222), i.e. upregulation of psp. Experimental setup as in panel b. Note that this upregulation is much stronger than the general increase of psp induction due to PspA overproduction, which we found to be largely dependent on PspBC (see panel d). (d) PspBC cause most of the inducing effect of long-term PspA overproduction. Comparison of changes in pspA reporter levels in the wild-type psp background (WT) or pspB and pspC single gene deletion mutants caused by production of either full-length PspA (1-222) or the fragment used in this study (1-144) in comparison to the empty vector control (empty). The 2.8-fold induction in the wild-type background is reduced to ~1.4-fold reporter levels in both deletion mutants. The only PspF interacting fragment PspA1-144 inhibits psp in all backgrounds.   (e) Co-elution of strep-tagged PspF with his-tagged full-length PspA-E37A from the reporter strain, with wild-type PspA shown as comparison (cf. Fig.4E)     Figure S5: PspA1-144∙ PspF1-265 complex formation.  (a) Size exclusion chromatography with  PspF1-265 and PspA1-144 indicates complex formation. Ratio of PspA relative to PspF is given on the left at the start of each chromatogram. PspA∙F appears at very low relative concentrations of PspA (0.17:1), while free PspA only appears at nearly equimolar concentrations. Preincubation with nucleotides (ATP/AMPPNP) and MgCl2 (second and third chromatogram from the top) does not change complex formation.  (b) Influence of  PspF1-265 concentration on self-hexamerization. Distribution of sedimentation coefficients of 1 or 10 µM PspF and their relative abundance (integrated absorption at 230 nm).   (c) Relative portion of the fast sedimenting species during titration (see Fig.5B) as percentage of total UV-absorption (230 nm) in the sample cuvette. Addition of 0.08 µM PspA1-144 already leads to a shift of 46% of  PspF1-265-absorption (the absorption of PspA is negligible at this point).  (d) Stable oligomerization of  PspF1-265 in equilibrium is not promoted by ADP. Distribution of sedimentation coefficients of 1 µM PspF with 0.05 to 0.5 mM ADP ( 5-fold KD) and their relative abundance (integrated absorption at 230 nm). Larger concentrations of ADP could not be measured due the high UV-absorption of nucleotides and the low amount of protein. Since  PspF1-265 shows ATPase-activity in vitro at 1 µM, this data does not exclude transient hexamer formation that occurs spontaneously. Still, stable oligomerization of PspF upon addition, which could be shown in the case of PspA (cf. Fig.5B), is not observed. (e) Determination of the apparent dissociation constant (koff) of the PspA∙F complex. Jump dilution (1:40) of the concentrated PspA1-144∙ PspF1-265 complex into the ATPase assay. The koff was determined (Tummino & Copeland, 2008) via curve fitting, with the hydrolysis rate of an equilibrated sample serving as reference rate.         Figure S6: Atomistic simulations of complex stability of PspA and PspF.  (a) Four independent atomistic simulations of PspA1-144 and PspF1-275 after 138 ns of simulated time (starting position of PspA was the same for all of them, shown in white cartoon representation, results of the four simulations in shades of orange superimposed on the right). Stable complex formation occurred when the FBR was facing PspF (schematically depicted on the left). In contrast, PspA diffuses away during simulation when PspA is rotated 180° around its longitudinal axis so that the FBR points away from PspF initially. In the superimposed pictures of simulations on the right, all PspFs were omitted for clarity but the two from the starting conditions, since PspF did not unfold or change its structure considerably during simulations.   (b) The modeled PspA1-144 ∙ PspF1-265 complex based on the stable binding conformation shown in panel b.   Supplemental Table S1. Primers used in this study. cloning of pspA1-144  pspA-F  CCATGGGTATTTTTTCTCGCTTTGC pspA144-R  CTCGAGCTGATGACGTAACATCAATGC single amino acid exchanges pspA-ex-E23A CTGTTAGAGAAAGCGGCTGATCCACAGAAACTGG / CCAGTTTCTGTGGATCAGCCGCTTTCTCTAACAG pspA-ex-D24A GAGAAAGCGGAAGCTCCACAGAAACTGG / CCAGTTTCTGTGGAGCTTCCGCTTTCTC pspA-ex-L28A GGAAGATCCACAGAAAGCGGTTCGTCTGATGATC / GATCATCAGACGAACCGCTTTCTGTGGATCTTCC pspA-ex-L31A CAGAAACTGGTTCGTGCGATGATCCAGGAGATG / CATCTCCTGGATCATCGCACGAACCAGTTTCTG pspA-ex-Q34A CTGGTTCGTCTGATGATCGCAGAGATGGAAGATACACTG / CAGTGTATCTTCCATCTCTGCGATCATCAGACGAACCAG pspA-ex-E37A GATGATCCAGGAGATGGCAGATACACTGGTTGAAG / CTTCAACCAGTGTATCTGCCATCTCCTGGATCATC pspA-ex-K55A CGTTGGCAGAAAAGGCACAGCTGACTCGC / GCGAGTCAGCTGTGCCTTTTCTGCCAACG pspA-ex-K55E CGTTGGCAGAAAAGGAACAGCTGACTCG / CGAGTCAGCTGTTCCTTTTCTGCCAACG pspA-ex-R59A GAAAAGAAACAGCTGACTGCCCGTATTGAACAAGCGTC / GACGCTTGTTCAATACGGGCAGTCAGCTGTTTCTTTTC pspA-ex-R59E GAAAAGAAACAGCTGACTGAACGTATTGAACAAGCGTCGG / CCGACGCTTGTTCAATACGTTCAGTCAGCTGTTTCTTTTC pspA-ex-Q136A CACGCGCTCGCGCCCAGGCATTGATGTTACGTCATCAGTGACTCGAGATATA / TATATCTCGAGTCACTGATGACGTAACATCAATGCCTGGGCGCGAGCGCGTG pspA-ex-Q136K CACGCGCTCGCAAACAGGCATTGATGTTACGTCATCAGTGACTCGAGATATA / TATATCTCGAGTCACTGATGACGTAACATCAATGCCTGTTTGCGAGCGCGTG  BspHI-dependent mutagenesis pspA-BspHI-L31-F1 TCATGATTCAGGAGATGGAAGATACAC pspA-BspHI-L31-R1 TCATGAGACGAACCAGTTTCTGTG pspA-BspHI-R30A TCATGAGTGCAACCAGTTTCTGTGGATCTTC pspA-BspHI-I33S TCATGAGCCAGGAGATGGAAGATACAC  pspA-BspHI-E35A TCATGATTCAGGCAATGGAAGATACACTGGTTGAAG pspA-BspHI-M36A TCATGATTCAGGAGGCAGAAGATACACTGGTTGAAGTACG pspA-BspHI-D38A TCATGATTCAGGAGATGGAAGCAACACTGGTTGAAGTACGTTCTAC   cloning of pspF  pspF-F2 CATATGGCAGAATACAAAGATAATTTACTTGGT pspF265-R2 GGATCCGGCGATAGCGTCTTCAG   pspF-R3 AAGCTTACTCGAGAATCTGGTGCTTTTTCAACAACG Primer sequences are given in 5'-3' direction.  1Primers used for introduction of a BspHI site at the position that codes for Leu31 in the amino acid sequence.  2Restriction sites at the 5' end of the primer are omitted for clarity (NdeI for pspF-F, BamHI for pspF265-R).  3 Reverse primer (5’ HindIII site) for cloning of pspF into pUL-Ptat contains a XhoI site before the HindIII site for future introduction of tags  Supplemental Table S2. Data collection and refinement statistics. Dataset PspA1-144 native Se-PspA1-144  MAD remote Se-PspA1-144 MAD peak Se-PspA1-144 MAD inflection Radiation source BESSY BL14.1 BESSY BL 14.1 BESSY BL 14.1 BESSY BL14.1 Wavelength (Å) Energy (kEV) 0.9184 13.5000 0.9759 12.7100 0.9798 12.6540 0.9799 12.6525 Resolution range (Å) Highest resolution shell (Å) 39.73 - 1.8 1.9 - 1.8 39.80 - 2.01 2.13 - 2.01 39.87 - 2.01 2.13 - 2.01 39.87 - 2.06 2.18 - 2.06 Space group C2 C2 C2 C2 Cell dimensions        a, b, c (Å) 79.65, 30.38, 80.48 79.72, 30.39, 80.70 79.95, 30.47, 80.87 79.94, 30.43, 80.94  () 90, 115.61, 90 90, 115.27, 90 90, 115.29, 90 90, 115.28, 90 Rmerge  3.1 (39.8) 5.2 (40.9) 4.7 (42.7) 4.8 (40.4) I / I 20.5 (3.5) 11.0 (2.0) 11.7 (1.9) 12.0 (2.0) Completeness (%) 96.8 (95.6) 96.8 (94.8) 96.7 (95.1) 96.8 (95.8) Multiplicity 3.4 (3.4) 2.2 (2.2) 2.2 (2.20) 2.2 (2.2) Wilson B 37.2 36.8 38.7 40.0 Refinement     No. reflections (work/test) 15170 / 798    Rwork / Rfree 0.213 / 0.264    No. atoms        Protein 1127       Buffer components 8       Water 77    B-factors (Å2)        Protein 54.5       Buffer components 71.8       Water 41.7    R.m.s deviations        Bond lengths (Å) 0.018       Bond angles () 1.87    Ramachandran plot (%)        Favoured    Allowed    Outlier 94.9 2.9 2.2    The values in parentheses are given for the highest resolution shell. For the native dataset Friedel pairs were merged, for the MAD datasets Friedel pairs were treated as separate reflections.   

http://hdl.handle.net/11858/00-001M-0000-0029-1E35-5

PspF-binding domain PspA1-144 and the PspA·F complex: New insights into the coiled-coil-dependent regulation of AAA+ proteins.

Abstract

Similar works

Full text

Available Versions

MPG.PuRe

MPG.PuRe