Background: Delhi, a city in north India, has so far witnessed several reported outbreaks of dengue. Dengue inDelhi from being epidemic is slowly changing towards being endemic and hyper-endemic. Circulating type ofthe virus is also changing over the years. In the absence of an effective vaccine, dengue prevention to a majorextent relies on virological surveillance, and development of effective, locally adapted control programmes. Inthe present study, we tried to identify the between-year non-epidemic serotype of dengue virus circulating inDelhi, during 2010–11.Methods: Acute-phase samples were collected from the patients attending the Institute of Liver & Biliary Sciences,New Delhi, India.  Dengue diagnosis was done using WHO case definitions.  All the samples were subjected toDengue NS1 Ag ELISA and modified nested RT-PCR.Results: A total of 75 acute-phase samples were received, of which 19 (25.3%) were positive for dengue NS1antigen. Dengue RT-PCR was positive in 14.6% (11/75) samples. All the RT-PCR isolates were of DENV-1serotype. No case of concomitant infection with more than one serotype was observed. Median age of involvementwas 23 yr (range10–86). Maximum number of cases were seen in the age group of 21–30 yr. Male to female ratiowas 1.2 : 1. Maximum number of suspected dengue cases (n=79) was seen during September and October.Conclusions: DENV-1 was circulating in Delhi in the year 2010–11 in non-epidemic period following reportedpredominance of DENV-3 and co-circulation of all dengue serotypes in the epidemic years 2003, 2006 and 2007

Ekta Gupta  , Sweta Mohan  , Meenu Bajpai  , Aashish Choudhary   & Gaurav Singh

Journal of Vector Borne Diseases

Directory of Open Access Journals

J Vector Borne Dis 49, June 2012, pp. 82–85Circulation of Dengue virus-1 (DENV-1) serotype in Delhi, during 2010–11after Dengue virus-3 (DENV-3) predominance: A single centrehospital-based studyEkta Gupta1, Sweta Mohan1, Meenu Bajpai2, Aashish Choudhary1 & Gaurav Singh11Department of Virology; 2Department of Transfusion Medicine, Institute of Liver and Biliary Sciences, New Delhi, IndiaABSTRACTBackground: Delhi, a city in north India, has so far witnessed several reported outbreaks of dengue. Dengue inDelhi from being epidemic is slowly changing towards being endemic and hyper-endemic. Circulating type ofthe virus is also changing over the years. In the absence of an effective vaccine, dengue prevention to a majorextent relies on virological surveillance, and development of effective, locally adapted control programmes. Inthe present study, we tried to identify the between-year non-epidemic serotype of dengue virus circulating inDelhi, during 2010–11.Methods: Acute-phase samples were collected from the patients attending the Institute of Liver & Biliary Sciences,New Delhi, India.  Dengue diagnosis was done using WHO case definitions.  All the samples were subjected toDengue NS1 Ag ELISA and modified nested RT-PCR.Results: A total of 75 acute-phase samples were received, of which 19 (25.3%) were positive for dengue NS1antigen. Dengue RT-PCR was positive in 14.6% (11/75) samples. All the RT-PCR isolates were of DENV-1serotype. No case of concomitant infection with more than one serotype was observed. Median age of involvementwas 23 yr (range10–86). Maximum number of cases were seen in the age group of 21–30 yr. Male to female ratiowas 1.2 : 1. Maximum number of suspected dengue cases (n=79) was seen during September and October.Conclusions: DENV-1 was circulating in Delhi in the year 2010–11 in non-epidemic period following reportedpredominance of DENV-3 and co-circulation of all dengue serotypes in the epidemic years 2003, 2006 and 2007.Key words Dengue; endemic; epidemic; non-epidemicINTRODUCTIONDengue viruses belong to the genus Flavivirus withinthe Flaviviridae family. Dengue is the most importantarboviral infection with four serotypes (DENV 1–4) thatare capable of producing disease ranging from self-limit-ing dengue fever (DF) to severe life-threatening denguehemorrhagic fever (DHF) and dengue shock syndrome(DSS)1. Each serotype has unique characteristics and canpresent with severe manifestations, in a particular popula-tion depending upon its interaction with the host response2.Epidemiology of dengue is ever changing in India. All thefour serotypes have been reported from India.  Delhi, acity in north India, has so far witnessed several reportedoutbreaks of dengue3. In the year 1996, DENV-2 wasresponsible for the massive epidemic followed by totalabsence for almost a decade4.  Following this, DENV-1was reported in the post-epidemic phase5. Co-circulationof all the four dengue serotypes with predominance ofDENV-3 was seen in outbreaks reported in 2003, 2005and 20066–8. In the years 2004 and 2008, DENV-1 wasisolated in the post-epidemic phase9.In the absence of an effective vaccine, dengue preven-tion to a major extent relies on virological surveillance,and development of effective, locally adapted controlprogrammes. Hence, continuous monitoring of circulatingtype of dengue virus is important in a given population todevelop such efficient local control programmes. Most stud-ies highlight the circulating serotypes during epidemics,however, between epidemics, there can be significant varia-tion for which public health systems are normally unpre-pared. In the present study, we tried to identify the be-tween-year non-epidemic serotype of dengue viruscirculating in Delhi in the year 2010–11.MATERIAL & METHODSAcute-phase samples (within 5 days of fever) werecollected from clinically suspected patients of dengue fe-ver presenting to the outpatient departments, emergencyservices and indoor services of our Institute from January2010 to May 2011. The samples were collected asepti-cally by venipuncture and centrifuged at 2000 rpm for 10min. Plasma samples were stored at –80°C till further test- 83Gupta et al: Dengue epidemiology in Delhiing. Clinical criteria for diagnosing dengue was based onWHO case definitions10.  All the samples were subjectedto Dengue NS1 Ag ELISA (PANBIO, Brisbane, Austra-lia) and modified nested single tube reverse transcriptasepolymerase chain reaction (RT-PCR).Viral RNA extractionDengue viral RNA was extracted from the patients’plasma, using QIAamp Viral RNA Mini Kit (Qiagen,Germany) as per the manufacturer’s protocol. The ex-tracted RNA was eluted in 60 l of elution buffer.cDNA synthesis and amplificationThe extracted viral RNA was reverse transcribed tocDNA using transcriptor first strand cDNA synthesis kit(Roche, Germany), and then amplified in the external roundof RT-PCR using dengue virus consensus primers (D1:5’ TCAATATGCTGAAACGCGCGAGAAACC G  3’;D2: 5’  TTGCACCAACAGTCAATGTCT TCA GGTTC  3’) in 25 l reaction volume. The DNA product ob-tained was of 511 bp.Semi-nested PCR (Internal round)Subsequent amplification of cDNA was carried outwith the dengue virus consensus forward primer (D1) andfour dengue serotype-specific reverse primers (TS 1: 5’CGTCTCAGTGATCCGGGGA 3’; TS 2: 5’ CGCCAC-AAGGGCCATGAACAG 3’; TS 3: 5’ TAACATCAT-CATGAGACAGAGC  3’; TS 4: 5’CTCTGTTGTCTT-AAACAAGAGA 3’) as described by Lanciotti et al11,but all the 4 serotype-specific primers were added in asingle reaction mixture. A 1 : 20 dilution of the externalPCR product was used in the nested PCR reaction. Den-gue virus serotypes were identified by the size of the re-sulting DNA bands (DENV 1–482 bp, DENV 2–119 bp,DENV 3–290 bp, DENV 4–392 bp).RESULTSA total of 75 acute-phase samples were received, ofwhich 19 (25.3%) were positive for dengue NS1 antigen.Dengue RT-PCR was positive in 14.6% (11/75) samples.All the RT-PCR isolates were of DENV-1 serotype. Nocase of concomitant infection with more than one sero-type was observed (Fig. 1). In cases where NS1 antigenwas positive but RT-PCR was negative, duration of feverwas 5 days, as by this time viremia declines and only NS1antigen persists till IgM antibodies are formed.The median age of 11 confirmed dengue cases was 23yr (range :10–86). Maximum number of cases was seenin the age group 21–30 yr (Fig. 2). Male to female ratiowas 1.2 : 1. Maximum number of suspected dengue cases(n=79) were seen in the months of September and October(Fig. 3). All the confirmed cases were followed up and inall complete clinical recovery was seen.DISCUSSIONDengue virus infection is a major, growing publichealth problem with an estimated 2.5 billion people at riskDNAladder(100 bp)    1          2          3          4        5         6         7DENV-1(482 bp)Fig. 1: A gel documentation image of nested RT-PCR.  Lane 1:Molecular weight markers (100 bp); Lanes 2, 6, 7: Positivesamples; Lanes 3, 4: Negative samples; and Lane 5: Negativecontrol (water).Fig. 2: Age-wise distribution of dengue and non-dengue cases.Maximum number of dengue cases seen in the age group of21–30 yr.454035302520151050Jan10 Mar Jul Aug Sept Oct Nov Dec Feb11 Mar Apr MayMonth1 14638411064971No.ofsuspecteddenguecasesFig. 3: Month-wise distribution of cases.  Maximum number ofdengue cases  seen during the months of September andOctober.25201510500–10 11–20 21–30 31–40 41–50 51–60 61–70 71–80 81–90YearNo.ofcasesDengue cases non-dengue cases J Vector Borne Dis 49, June 201284of infection. Dengue viruses cause a range of well-de-scribed clinical illnesses. Infection ranges from an asymp-tomatic infection to a self-limiting febrile illness, DF, tosevere dengue, a clinical syndrome that typically presentswith capillary permeability and can lead to DSS and DHF.Dengue epidemics can have a significant economicand health toll in any country. Globally dengue transmis-sion has expanded in recent years and all the four denguevirus serotypes (DENV 1–4) are now circulating in Asia,Africa and the Americas, a dramatically different scenariofrom that which prevailed 20 or 30 years ago12. Develop-ment of effective surveillance and disease preventionprogrammes for any disease depend a lot on the account-ing for variation in the epidemiology.In north India, epidemiology of dengue is changingfast and from epidemic pattern it has now become endemicin most of the cities. Incidence of fatal DHF and DSScases, which are medical emergencies, are also on the rise13.History of dengue epidemics in Delhi and circulatingserotype is interesting14. Both circulating as well aspredominant strain of the virus kept changing as depictedin Table 1. In 1967, major outbreak was reported byDENV-215,16 after a gap of almost 3 decades major hem-orrhagic outbreak by DENV-2 occurred. Since then, apartfrom brief occurrence of DENV-1 in 1997, DENV-2 domi-nated the circulation in Delhi. This was replaced by co-circulation of all types in 2003 followed by complete pre-dominance of DENV-3. Co-circulation of all the serotypesand concurrent infection with multiple serotypes was re-ported, which clearly indicates endemicity of dengue inthis region3,17. Increasing frequency of outbreaks with co-circulation of all serotypes also hint at hyperendemicityof dengue in Delhi. This may be attributed to several fac-tors like rapidly growing population, increasing urbaniza-tion and lack of effective vaccine and vector controlprogrammes. Continuous monitoring of dengue infectionand its trend is essential in any endemic area to preventfurther epidemic transmission of this virus and also it willhelp in the development of local control programmes18.However, most of the studies focus on epidemics and veryfew studies have been done to find out the circulating typeof dengue virus in the non-epidemic period. In the present study, we found the circulation ofDENV-1 type in Delhi during the non-epidemic period of2010–11 after complete predominance of DENV-3 in ear-lier reported outbreaks3,7,8. Epidemic causing aggressiveand more pathogenic strain is always replaced by milderstrain of the virus during the non-epidemic period. Earliersimilar pattern was observed following massive outbreakby DENV-2 in Delhi in the year 1996 following whichDENV-1 strain predominated the circulation in the non-epidemic period5. Clinical significance of the findings arethat most of the people living in Delhi are probably im-mune to DENV-3  and DENV-1 but chances of an out-break by less prevalent serotypes are still there. Subse-quent infection with different serotype of the virus leadsto more severe clinical disease due to antibody enhance-ment phenomenon. Mosquito control programme needs tobe more active to prevent any future outbreak.Our study also shows that in the non-epidemic periodusually one strain circulates and co-circulation of mul-tiple types with concurrent infection with more than oneserotype is not seen. Another finding in our study was theshifting trend of the age group being mostly affected. Den-gue affects all the age groups but certain age groups maybe more prone to being affected in different parts of theworld. It may be regarded as a disease mainly affectingchildren (<10 yr of age) or it may be characterized as anadult-onset disease. In the present study and in other well-documented studies from north India, it has been foundthat the age-group 21–30 yr, is the most affected6. Whereascontemporary studies from south India found children tobe more vulnerable than adults, to dengue infection19. Withhousehold mosquito elimination programmes on an over-drive, dengue-causing Aedes mosquitoes seemingly infectthe young employed population which is mostly outdoors.Our finding further corroborates that dengue infection inDelhi more commonly affects the age group 21–30 yr.Maximum cases were seen during the months of Septem-ber–October in concordance with various other studies andsimilar to that is seen during epidemic period. This is dueto post-monsoon collection of water and increased avail-ability of breeding sites for the Aedes mosquito.CONCLUSIONThe problem of dengue is huge in our country andneeds proper implementation of control measures beforeTable 1. Circulation of various dengue virus serotypes in DelhiYear DENV Epidemic/ Referencesserotype non-epidemic1967 2 Epidemic Balaya et al15,Singh et al161996 2 Epidemic Dar et al41997 1 Non-epidemic Vajpayee et al52003 1,2,3,4 Epidemic Gupta et al72004 1 Non-epidemic Gupta et al32005 3 Epidemic Gupta et al32006 3 Epidemic Bharaj et al82008 1 Non-epidemic Chakravarti et al92010 1 Non-epidemic Present study. 85Gupta et al: Dengue epidemiology in Delhiany further huge epidemic occurs. All of us have devel-oped immunity to DENV-3 but DENV-1 serotype is re-placing DENV-3 in Delhi which is new to the populationand may take a form of epidemic strain. Adequate andtimely preventive measures should be taken to prevent anyfuture epidemic. Such issues may be of interest to epide-miologists and virologists for planning effective controlof the virus or future vaccine development. Futureendeavours should be made to develop improved labora-tory-based surveillance systems that can forecast impend-ing dengue epidemics.REFERENCES1. Gubler DJ. Dengue and dengue haemorrhagic fever. ClinMicrobiol Rev 1998;11: 480–96.2. Guzman MG, Kourf G. Dengue: An update. The Lancet InfectDis 2002, 2: 33–42.3. Gupta E, Dar L, Kapoor G, Broor S. The changing epidemiol-ogy of dengue in Delhi, India. Virol J 2006; 3: 1–5.4. Dar L, Broor S, Sengupta S, Xess I, Seth P. The first majoroutbreak of dengue haemorrhagic fever in Delhi. Emerg InfectDis 1999; 5: 589–90.5. Vajpayee M, Mohankumar K, Wali JP, Dar L, Seth P, Broor S.Dengue virus infection during post-epidemic period in Delhi,India. Southeast Asian J Trop Med Public Health 1999; 30:507–10.6. Gupta E, Dar L, Narang P, Srivastava VK, Broor S. Serodiag-nosis of dengue during an outbreak at a tertiary care hospital inDelhi. Indian J Med Res 2005; 121: 36–8.7. Dar L, Gupta E, Narang P, Broor S. Co-circulation of Dengueserotypes, Delhi, India. Emerg Infect Dis 2006; 12: 352–3.8. Bharaj P, Chahar HS, Pandey A, Diddi K, Dar L, Guleria R,Kabra SK, Broor S. Concurrent infections by all four denguevirus serotypes during an outbreak in 2006, Delhi, India. VirolJ 2008; 9: 5–10.9. Chakravarti A, Kumar A, Matlani M. Displacement of denguevirus types 3 and 2 by type 1 in Delhi during 2008. Indian JMed Microbiol 2010; 28: 412.10. Dengue hemorrhagic fever: diagnosis, treatment and control.II edn. Geneva: World Health Organization 1997. Available from: http://www.who.int/csr/resources/publications/dengue/012-23.pdf.  [Accessed  on November 26, 2011].11. Lanciotti RS, Calisher CH, Gubler DJ,Chang GJ, Vorndam AV.Rapid detection and typing of dengue viruses from clinicalsamples by using reverse transcriptase-polymerase chain reac-tion. J Clin Microbiol 1992; 30: 545–51.12. Guzman MG, Halstead SB, Artsob H, Buchy P, Farrar J, GublerDJ, et al. Dengue: a continuing global threat. Nature RevMicrobiol 2010; 8: S7–S16.13. Dash PK, Parida MM, Saxena P, Abhyankar A, Singh CP, TewariKN, et al. Re-emergence of dengue virus type 3 (subtype III) inIndia: Implications for increased incidences of DHF, DSS. VirolJ 2006; 3: 1–10.14. Chaturvedi UC, Nagar R.  Dengue and dengue haemorrhagicfever: Indian perspective. J Biosci 2008; 33: 429–41.15. Balaya S, Paul SD, D’Lima LV, Pavri KM. Investigations on anoutbreak of dengue in Delhi in 1967. Indian J Med Res 1969;57: 767–74.16. Singh UB, Maitra A, Broor S, Rai A, Pasha ST, Seth P. Partialnucleotide sequencing and molecular evolution of epidemic caus-ing Dengue 2 strains.  J Infect Dis 1999; 180: 959–65.17. Gupta E, Dar L, Broor S. Concurrent infection by two denguevirus serotypes among dengue patients. Indian J Med Microbiol2008; 26: 402–3.18. Gore MM. Need for constant monitoring of dengue infections.Indian J Med Res 2005; 121: 9–12.19. Gunasekaran P, Kaveri K, Mohana S, Arunagiri K, BabuBV, Priya PP, et al. Dengue disease status in Chennai(2006–08): A retrospective analysis. Indian J Med Res 2011;133: 322–5.Correspondence to: Dr Ekta Gupta, Department of Virology, Institute of Liver and Biliary Sciences (ILBS), D-1, Vasant Kunj,New Delhi–110 070, India.E-mail: ektagaurisha@gmail.comReceived: 24 January 2012 Accepted in revised form: 17 May 2012

Circulation of Dengue virus-1 (DENV-1) serotype in Delhi, during 2010–11 after Dengue virus-3 (DENV-3) predominance: A single centre hospital-based study

http://doaj.org/search?source=%7B%22query%22%3A%7B%22bool%22%3A%7B%22must%22%3A%5B%7B%22term%22%3A%7B%22id%22%3A%2277465128afbf4b779db3a4aeb82cbdb1%22%7D%7D%5D%7D%7D%7D

Circulation of Dengue virus-1 (DENV-1) serotype in Delhi, during 2010–11 after Dengue virus-3 (DENV-3) predominance: A single centre hospital-based study

Abstract

Similar works

Full text

Available Versions

Directory of Open Access Journals