A nodule-shaped microbial mat was found subsurface in sediments of a gas seep in the anoxic Black Sea. This mat was dominated by ANME-1 archaea and consumed methane and sulfate simultaneously. We propose that such subsurface mats represent the initial stage of previously investigated microbial reefs

Blumenberg, M.

Boetius, A.

Knittel, K.

Seifert, R.

Treude, T.

English

MPG.PuRe

APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Oct. 2005, p. 6375–6378 Vol. 71, No. 100099-2240/05/$08.000 doi:10.1128/AEM.71.10.6375–6378.2005Copyright © 2005, American Society for Microbiology. All Rights Reserved.Subsurface Microbial Methanotrophic Mats in the Black Sea†Tina Treude,1,2* Katrin Knittel,1 Martin Blumenberg,3 Richard Seifert,3 and Antje Boetius1,4Max Planck Institute for Marine Microbiology, Celsiusstraße 1, 28359 Bremen, Germany1; Alfred Wegener Institutefor Polar and Marine Research, Am Handelshafen 12, 27570 Bremerhaven, Germany2; Institute ofBiogeochemistry and Marine Chemistry, University of Hamburg, Bundesstrasse 55, 20146Hamburg, Germany3; and International University of Bremen, Campusring 1,28759 Bremen, Germany4Received 2 February 2005/Accepted 22 April 2005A nodule-shaped microbial mat was found subsurface in sediments of a gas seep in the anoxic Black Sea.This mat was dominated by ANME-1 archaea and consumed methane and sulfate simultaneously. We proposethat such subsurface mats represent the initial stage of previously investigated microbial reefs.In permanently anoxic parts of the northwestern Black Sea,methanotrophic microbial reefs that are up to 4 m high and1 m in diameter thrive above methane seeps characterized bystrong emanation of gas bubbles (3, 9, 12). Similar microbialreef systems have recently been found in several areas of theBlack Sea shelf (B. B. Jørgensen and scientific party, Poseidoncruise POS 317-3 2004). The surface reef structures consist ofmicrobial mats that are up to 10 cm thick enclosing porouscarbonates. Biomarker and stable isotope analyses have shownthat the precipitation of the carbonate is associated with theanaerobic oxidation of methane (AOM) (13, 15). In this study,sediment push cores (diameter, 60 mm) were obtained by thesubmersible Jago (MPI Seewiesen, Germany) within 1 m of agas-emanating microbial reef structure (water depth, 313 m;44°44.202N, 31°47.333E; GHOSTDABS station 68). In twoadjacent push cores an approximately 4-cm-thick subsurfacemat was discovered below a sediment depth of 10 cm. The mathad a spherical nodule-like shape and was very soft; i.e., nocarbonate incrustations were detected visually during section-ing and dissection. Below an outer black layer that was a fewmillimeters thick the mat appeared pinkish, similar to the matsgrowing on the reef structures. The two push cores were sam-pled by taking five subcores (diameter, 26 mm) (Fig. 1a) toidentify the dominant microbial populations and to measurethe rates of AOM and sulfate reduction (SR), the concentra-tion and stable carbon isotope signatures of methane, and theconcentration of sulfate at 1-cm intervals above, within, andbelow the mat. The microbial community of the mat was ana-lyzed by examining one of the subcores by fluorescence in situhybridization of sonicated samples (8) (Table 1). A majorfraction (estimate, 50%) of the mat consisted of ANME-1cells. No aggregates or single cells of ANME-2 archaea weredetected by epifluorescence microscopy. rRNA slot blot hy-bridization was used to obtain a semiquantitative estimate ofmicrobial abundance around and within the subsurface mat.RNA extraction, blotting, and hybridization using 33P-labeledoligonucleotide probes (Table 1) were performed as describedpreviously (14). Quantitative rRNA slot blot hybridization con-firmed that ANME-1 was the dominant group within the mat(up to 40% ANME-1 rRNA in the total rRNA) (Fig. 1b) andshowed that this taxon accounted for 83% of total archaealRNA in these layers (data not shown). Slot blot hybridizationof sulfate-reducing bacteria (SRB) belonging to the Desulfo-coccus-Desulfosarcina cluster revealed a concentration of 16SrRNA in the mat that was similar to that in the surroundingsediments (Fig. 1b); the level increased only slightly, from 5%at the sediment surface to 11% of the total 16S rRNA withinthe mat (6 to 27% of the total bacterial rRNA [data notshown]). The AOM and SR rates were determined for twoseparate subcores by 24 h of incubation with 14CH4 and35SO42 radiotracers by using the whole-core injection method(6). Incubation was performed at the in situ temperature (9°C).AOM and SR samples were fixed, stored, and analyzed asdescribed previously (16, 7). Concentrations and stable carbonisotope signatures of methane were analyzed by gas chroma-tography and gas chromatography-stable isotope mass spec-trometry, respectively (12). Sulfate concentrations were deter-mined for one subcore in the supernatant of sediment fixedwith zinc acetate (20%, wt/wt) using nonsuppressed ion chro-matography (5). The activity profiles measured reflected thedistribution of the ANME-1-dominated mat. High AOM andSR activities were detected within the mat (Fig. 1c), and thedata revealed a close 1:1 coupling between the two processes.The peaks of methanotrophic activity (AOM, 1.5 mol cm3day1 at 12 to 13 cm; SR, 1.8 mol cm3 day1 at 11 to 12 cm)coincided with the center of the mat, where the steepest gra-dient in the pore water methane content (Fig. 1d) was mea-sured. The methane concentration decreased from the atmo-spheric saturation level (1.3 mM) below the mat to 0.1 mMabove the mat. Stable carbon isotope signatures of the meth-ane profile generally indicated that there was methanotrophybecause 13C values increased from 70.2 ‰ below the mat to61.7‰ or less above the mat. However, most interestingly,the 13C value of methane directly underneath the AOM peak(73.7 ‰) showed a minimum and was lower than the re-ported isotope signatures of methane seeping in this area (min-imum, 68.3 ‰) (12). This may indicate that there was netmethanogenic activity in this part of the mat, which we could* Corresponding author. Mailing address: Max Planck Institute forMarine Microbiology, Celsiusstraße 1, 28359 Bremen, Germany.Phone: 49 421 2028630. Fax: 49 421 2028690. E-mail: ttreude@mpi-bremen.de.† Publication no. 15 of the GHOSTDABS project and publicationno. 135 of the GEOTECHNOLOGIEN program.6375 on December 10, 2020 by guesthttp://aem.asm.org/Downloaded from not investigate further. The concentration of sulfate, the elec-tron acceptor of AOM, decreased from 11 mM in the surfacesediments to a minimum of 2 mM within the mat (Fig. 1e). Inconclusion, the subsurface microbial mat studied in this inves-tigation met all of the following characteristics of the reef matsdescribed in previous studies (3, 12): (i) nodule-shaped growth,(ii) pinkish color with a blackened surface, (iii) simultaneousconsumption of methane and sulfate under anoxic conditions,FIG. 1. Parameters measured in the sediment containing a subsurface microbial mat. (a) Position of the microbial mat (arrow) in one of the subcores;(b) percentages of archaeal ANME-1 and bacterial Desulfococcus-Desulfosarcina (DSS) rRNA in the total small-subunit (ssu) rRNA; (c) rates of AOMand SR; (d) concentrations and stable carbon isotope signatures of methane (13C values; n  3; standard errors, 	1 ‰); (e) concentrations of sulfate.TABLE 1. Oligonucleotide probes used for fluorescence in situ hybridization and slot blot hybridization in sediment-mat samplesProbe Specificity Sequence (5 to 3) PositionaSlot blotdenaturationtemp (°C)Formamide concn(%, vol/vol)b ReferenceUni1390 All organisms GACGGGCGGTGTGTACAA 1390–1407 44 Not used 17EUB338 Bacteria GCTGCCTCCCGTAGGAGT 338–355 54 35 1ARCH915 Archaea GTGCTCCCCCGCCAATTCCT 915–935 56 35 2ANME-2-538 ANME-2 cluster GGC TAC CAC TCG GGC CGC 538–555 Not used 50 This studyANME-1-350 ANME-1 cluster AGT TTT CGC GCC TGA TGC 350–367 60 50 4DSS658 Desulfosarcina spp./Desulfococcusspp. clusterTCCACTTCCCTCTCCCAT 658–685 58c 60 11a Position in the 16S rRNA of Escherichia coli.b Formamide concentration in the hybridization buffer used in fluorescence in situ hybridization.c Washing buffer containing 1 SSC and 0.1% sodium dodecyl sulfate was used (1 SSC is 0.15 M NaCl plus 0.015 M sodium citrate).6376 TREUDE ET AL. APPL. ENVIRON. MICROBIOL. on December 10, 2020 by guesthttp://aem.asm.org/Downloaded from and (iv) dominance of methanotrophic ANME-1 archaea as-sociated with the Desulfococcus-Desulfosarcina SRB. However,in contrast to the reef mats, the subsurface mat did not containvisually detectable carbonate precipitates. We therefore pro-pose that the subsurface growth represents the preliminarystage of microbial reef formation. Most likely, the slowly grow-ing communities of methanotrophic archaea accumulatearound gas leakage pathways where sulfate is still available.The growth into a densely aggregated mat could even supportgas trapping. It was observed visually during dives that surfacereef nodules retain free gas in interior cavities, apparentlycausing an overpressure within the nodule (9). The formationof the reef (Fig. 2) may proceed by gradual calcification of thesubsurface mat forming a basement around the gas channelsand finally growth into the water column supported by thecalcareous core. The direction of growth of the reef seems tobe relatively vertical from the sediment into the water columnsince the nodule-like mats on top of the reefs represent theyoungest structures, as confirmed by 90Sr detections (9). Instudies investigating methane seeps at the transition from oxicwater to anoxic water of the Black Sea (water depth, 60 to230 m), scientists reported a successive increase from bottom-level pancake-like carbonate cements with interior mat inclu-sions in the oxic zone to 1-m-high carbonate-mat chimneysextending into the water column of the anoxic zone (10, 13).The presence of oxygen in the water column evidently limitsthe vertical growth of the methanotrophic mats. One advan-tage of the reef-forming growth pattern within the anoxic zonewould be maximized access to sulfate. Within the sediment,diffusion limits the supply of sulfate, but the upward growthinto chimney-like structures along gas leakage pathways couldfacilitate the supply of sulfate from the surrounding water.We thank the officers, crew, and shipboard scientific party of RVProf. LOGACHEV and the JAGO Team for excellent support duringthe cruise. Special thanks are due to the chief scientist, W. Michaelis,as well as M. Böttcher for sulfate measurements. We also thank thetwo anonymous reviewers for their constructive remarks.This study was made possible by the programs MUMM (03G0554A)and GHOSTDABS (03G0559A), supported by the Bundesministeriumfür Bildung und Forschung (Germany). Further support came fromthe Max-Planck-Gesellschaft (Germany).REFERENCES1. Amann, R. I., B. J. Binder, R. J. Olson, S. W. Chisholm, R. Devereux, andD. A. Stahl. 1990. Combination of 16S rRNA-targeted oligonucleotideprobes with flow cytometry for analyzing mixed microbial populations. Appl.Environ. Microbiol. 56:1919–1925.2. Amann, R. I., L. Krumholz, and D. A. Stahl. 1990. Fluorescent-oligonucle-otide probing of whole cells for determinative, phylogenetic, environmentalstudies in microbiology. J. Bacteriol. 172:762–770.3. Blumenberg, M., R. Seifert, J. Reitner, T. Pape, and W. Michaelis. 2004.Membrane lipid patterns typify distinct anaerobic methanotrophic consortia.Proc. Natl. Acad. Sci. USA 101:11111–11116.4. Boetius, A., K. Ravenschlag, C. J. Schubert, D. Rickert, F. Widdel, A.Giesecke, R. Amann, B. B. Jørgensen, U. Witte, and O. Pfannkuche. 2000. Amarine microbial consortium apparently mediating anaerobic oxidation ofmethane. Nature 407:623–626.5. Ferdelman, T. G., C. Lee, S. Pantoja, J. Harder, B. M. Bebout, and H.Fossing. 1997. Sulfate reduction and methanogenesis in a Thioploca-domi-nated sediment off the coast of Chile. Geochim. Cosmochim. Acta 61:3065–3079.6. Jørgensen, B. B. 1978. A comparison of methods for the quantification ofbacterial sulphate reduction in coastal marine sediments. I. Measurementswith radiotracer techniques. Geomicrobiol. J. 1:11–27.7. Kallmeyer, J., T. G. Ferdelman, A. Weber, H. Fossing, and B. B. Jørgensen.2004. A cold chromium distillation procedure for radiolabeled sulfide ap-plied to sulfate reduction measurements. Limnol. Oceanogr. Methods 2:171–180.8. Knittel, K., T. Lösekann, A. Boetius, R. Kort, and R. Amann. 2005. Diversityand distribution of methanotrophic archaea (ANME) at cold seeps. Appl.Environ. Microbiol. 71:467–479.9. Lein, A. Y., M. V. Ivanov, N. V. Pimenov, and M. B. Gulin. 2002. Geochemi-cal characteristics of the carbonate constructions formed during microbialFIG. 2. Suggested stages of formation of methanotrophic microbial reefs in the anoxic zone observed at different locations in the study area.(a) Uncalcified subsurface microbial mat; (b) breakthrough of nodule-shaped microbial structures into the water column (height, approximately20 cm); (c) advanced growth into the water column and formation of calcified basement (40 cm); (d) chimney-like reef structures with a calcifiedinner core surrounded by microbial mat and soft nodule-shaped microbial structures on top (150 cm). 1, subsurface nodule; 2, surface nodule;3, surface reef structure; 4, carbonate basement. The picture sources were project MUMM (a) and project GHOSTDABS/Jago Team, MPISeewiesen (b to d).VOL. 71, 2005 SUBSURFACE MICROBIAL METHANOTROPHIC MATS 6377 on December 10, 2020 by guesthttp://aem.asm.org/Downloaded from oxidation of methane under anaerobic conditions. Mikrobiologiya 71:89–103.10. Luth, C., U. Luth, V. Gebruck, and H. Thiel. 1999. Methane seeps along theoxic/anoxic gradient in the Black Sea: manifestations, biogenic sedimentcompounds, and preliminary results on benthic ecology. Pubbl. Stn. Zool.Napoli Mar. Ecol. 20:221–249.11. Manz, W., M. Eisenbrecher, T. R. Neu, and U. Szewzyk. 1998. Abundanceand spatial organization of Gram-negative sulfate-reducing bacteria in acti-vated sludge investigated by in situ probing with specific 16S rRNA targetedoligonucleotides. FEMS Microbiol. Ecol. 25:43–61.12. Michaelis, W., R. Seifert, K. Nauhaus, T. Treude, V. Thiel, M. Blumenberg,K. Knittel, A. Gieseke, K. Peterknecht, T. Pape, A. Boetius, A. Aman, B. B.Jørgensen, F. Widdel, J. Peckmann, N. V. Pimenov, and M. Gulin. 2002.Microbial reefs in the Black Sea fueled by anaerobic oxidation of methane.Science 297:1013–1015.13. Peckmann, J., A. Reimer, U. Luth, C. Luth, B. T. Hansen, C. Heincke, J.Hoefs, and J. Reitner. 2001. Methane-derived carbonates and authigenicpyrite from the northwestern Black Sea. Mar. Geol. 177:129–150.14. Ravenschlag, K., K. Sahm, C. Knoblauch, B. B. Jørgensen, and R. Amann.2000. Community structure, cellular rRNA content, and activity of sulfate-reducing bacteria in marine Arctic sediments. Appl. Environ. Microbiol.66:3592–3602.15. Thiel, V., J. Peckmann, H. H. Richnow, U. Luth, J. Reitner, and W. Michae-lis. 2001. Molecular signals for anaerobic methane oxidation in Black Seaseep carbonates and microbial mat. Mar. Chem. 73:91–112.16. Treude, T., A. Boetius, K. Knittel, K. Wallmann, and B. B. Jørgensen. 2003.Anaerobic oxidation of methane above gas hydrates at Hydrate Ridge, NEPacific Ocean. Mar. Ecol. Prog. Ser. 264:1–14.17. Zheng, D., E. W. Alm, D. A. Stahl, and L. Raskin. 1996. Characterization ofuniversal small subunit rRNA hybridization probes for quantitative molec-ular microbial ecology studies. Appl. Environ. Microbiol. 62:4314–4317.6378 TREUDE ET AL. APPL. ENVIRON. MICROBIOL. on December 10, 2020 by guesthttp://aem.asm.org/Downloaded from 

Subsurface microbial methanotrophic mats in the Black Sea

http://hdl.handle.net/21.11116/0000-0007-8CDF-1

Subsurface microbial methanotrophic mats in the Black Sea

Abstract

Similar works

Full text

Available Versions

MPG.PuRe