D'Auria, J.

Docimo, T.

Gershenzon, J.

Kai, M.

Kunert, G.

Reichelt, M.

Schneider, B.

English

MPG.PuRe

The first step in the biosynthesis of cocaine in Erythroxylum coca: the characterization of arginine and ornithine decarboxylases Docimo Teresa1, Reichelt Michael1, Schneider Bernd2, Marco Kai3, Kunert Grit1, Gershenzon Jonathan1 and D’Auria John C.1   Max Planck Institute for Chemical Ecology 1Department of Biochemistry, Max Planck Institute for Chemical Ecology, Jena  2NMR Research Group, Max Planck Institute for Chemical Ecology, Jena 3Mass Spectrometry Research Group, Max Planck Institute for Chemical Ecology, Jena Beutenberg Campus, Hans-Knöll-Straße 8 D-07745 Jena, Germany Corresponding Author D’Auria John C Department of Biochemistry Max Planck Institute for Chemical Ecology D-07745 Jena, Germany                  Supplementary Material     Fig 1 Developmental stages of E .coca leaves investigated from youngest to oldest: buds, rolled leaves ( Leaf stage I), , expanding leaves (Leaf stage II) , and mature leaves  (Leaf stage III).                                        Fig2.LC-MS ion trap chromatogram comparison of methylecgonine derivatives in samples of stem cuttings treated with [U-13C]glucose solution or with unlabeled glucose. a-b) MS2 of cocaine shows 13C enrichment of the methylecgonidine fragment (m/z 182) in a sample from unlabeled cuttings a) compared to one from 13C-labeled cuttings b). c-d) MS2 of cinnamoyl cocaine shows 13C enrichment of the methylecgonidine fragment in a sample from unlabeled cuttings c)compared to one from 13C-labeled cuttings. d)     Fig3 Gene Ontology annotations for E. coca EST collection. Shown are percentage representations of the 3 top hierarchical annotations: molecular function, cellular component, and biological processes.          Fig 4 Demonstration of ornithine decarboxylase activity for E. coca ODC in in vitro assay.  Depicted are HPLC chromatograms with fluorescence detection of OPA derivatives for a) putrescine standard, b) extract of E. coli transformed with pET32 empty vector assayed with ornithine as substrate, c) His-Tag purified pET32::EcODC expressed in E. coli assayed with ornithine, d). His-Tag purified pET32::EcODC expressed in E. coli assayed with arginine e) Standard of cadaverine, product of lysine decarboxylation f) lysine Standard g) His-Tag purified E. coca ODC tested with lysine showing lack of activity. Retention times are; lysine, 23.7 min;,and cadaverine, 29.3 min.                        Fig5 E. Coca ODC activity measured at varying pH (above) and with varying monovalent and divalent ions in the assay buffer at a final concentration of 3mM(below)          Fig6. Demonstration of arginine decarboxylase activity for E. coca ADC in in vitro assay. Depicted are LC chromatograms of the assay with MS triple quadrupole detection of a) purified pET32:: EcADC expressed in E. coli, b) extract of E. coli transformed with pET32 empty vector, and c) pET32::EcADC boiled enzyme.      Table 1 Relative stability ranking of internal reference genes made according to a previously described method (Vandesompele et al., 2002)  Rank Genes geNorm 1 PeX4 1.447 2 PP2AA2 0.725  3 EF1α 0.822  4 ATPTB1 0.752 5 APT2 1.086  6 Actin 0.982 7 11242 0.741 8 10131 0.734  9 6402 0.722                         Fig7 Detection of 13C incorporation in cinnamoyl moiety of cinnamoyl cocaine after [U-13C]glucose feeding. Depicted is the 13C-NMR spectrum with signals colored for relative degree of enrichment.                        Fig8 Detection of 13C-label in methyl salicylate in rolled leaves after feeding with a 13C glucose solution compared with being fed with unlabeled glucose. Shown is the GC-MS total ion trace (top) and mass spectrum of methyl salicylate from [13C]glucose-fed (middle) and glucose-fed (bottom) plants.           Table 2 Description of Primers used for PCR and qPCR Gene Accession. number Sequence Orientation Purpose NtODC AAB65826 CCTCTCTCTTTTCTTCCTTTGTTTGG For Library screening NtODC  CCATCAAAACCACGGTAGTAATTCC Rev  AttbODC JF909553 CTGGTTCCGCGTGGTTCCATGCCAACTTT For Cloning/PCR AttbODC  CAAGAAAGCTGGGTCCTACGGATTGGAATAGGCA Rev  qODC  GAAGAGGAACGAAAGCAAAGAGC For qPCR qODC  CGGGAGAGACACGGAGAGAC Rev  pYesODC  CTGGTTCCGCGTGGTTCCAAAATGCCAACTTT For Cloning/PCR PYesODC  CAAGAAAGCTGGGTCCGGATTGGAATAGGCAA Rev  ADC JF909552 ATGGACGGTTGGGGTGCT For Sequencing ADC  AACCGAAATGACCCGCATGT Rev  AttbADC  CTGGTTCCGCGTGGTTCCATGGACGGTTG For Cloning/PCR AttbADC  CAAGAAAGCTGGGTCTCAAGCACAACAATAAGA Rev  qADC  GCAGCGGTGGAGGCAGAG For qPCR qADC  CTGCTGCTGCTGCTGCTGA Rev  Reference genes for qPCR   qEF1α JN020156 TGGAGGTATTGACAAGCGTGTGATTGAGAG For qPCR qEF1α  TTTGACACCAAGAGTGAAAGCAAGAAGAGC Rev  qACTIN JN020155 GGATTTCCAAAGGTGAATACGATG For qPCR qACTIN  TTGAACCAGCAAAGTTGAATAAGC Rev  q10131 JN020153 TGGAAGGGTAGTGGGGTAACAATG For qPCR q10131  GAGCGTAGTCGTCAGAGAAGGC Rev  q6409 JN020150 GAAGAGACAAGTGGTGGGGTGAG For qPCR q6409  AGAAGAGAGCAAAGAGGAAGAGTGG Rev  q11242 q11242 qAPT2 qAPT2 JN020151  JN020149  ACATTACCAAAGCAGGCTCATACG TACATCTTCTCACCACCAACACAGC ACTCAGAGAGCGAGAGAGGATGTTT TCAACTCCAGCAACCACAGAAATG For Rev For Rev qPCR  qPCR  qPEX4 qPEX4 qTIP41 qTIP41 qPTPB qPTPB JN20157  JN20154  JN20152 GTCGGTTCTTTAGCAAGGTCAGTG CGTGGTGGCGGTGGTGG TGCTCCTGTTATGGGTCCTGAAG CATCTGGGTCCTCACTCAACTCC CCGATTGAAGCCATAACAGGAGAC CTGGTGCTGGTCCTGTGGG For  Rev For Rev For Rev qPCR  qPCR  qPCR                             

The first step in the biosynthesis of cocaine in Erythroxylum coca: the characterization of arginine and ornithine decarboxylases

https://pure.mpg.de/pubman/item/item_1351591_7/component/file_3151703/GER321s1.pdf

The first step in the biosynthesis of cocaine in Erythroxylum coca: the characterization of arginine and ornithine decarboxylases

Abstract

Similar works

Full text

Available Versions

MPG.PuRe

MPG.PuRe