Here we present a modification of the widely used pET29 expression vector for use in rapid and straightforward parallel cloning via a gene replacement and Golden Gate strategy. The modification can be applied to other expression vectors for Gram-negative bacteria. We have used the modified vectors to clone large numbers of bacterial natural enzyme variants from genomic and metagenomic sources for applications in biocatalysis

Dobrijevic, D

Hailes, HC

Nematollahi, LA

Ward, JM

English

UCL Discovery

BenchmarkpET expression vector customized for efficientseamless cloningDragana Dobrijevic1, Lily A Nematollahi2, Helen C Hailes3 & John M Ward*,11Department of Biochemical Engineering, University College London, Gower Street, London, WC1E 6BT, UK; 2Synthace Ltd, The Westworks, 195 Wood Lane, London, W127FQ, UK; 3Department of Chemistry, University College London, 20 Gordon Street, London, WC1H 0AJ, UK; *Author for correspondence: j.ward@ucl.ac.ukBioTechniques 69: 00–00 (June 2020) 10.2144/btn-2020-0101First draft submitted: 13 July 2020; Accepted for publication: 8 September 2020; Published online: 30 October 2020ABSTRACTHere we present a modification of the widely used pET29 expression vector for use in rapid and straightforward parallel cloning via a genereplacement and Golden Gate strategy. The modification can be applied to other expression vectors for Gram-negative bacteria. We have usedthe modified vectors to clone large numbers of bacterial natural enzyme variants from genomic and metagenomic sources for applications inbiocatalysis.METHOD SUMMARYThe pET29 vector was modified to contain, instead of the multiple cloning site, a negative selection marker (sacB) flanked by Type IIs restrictionsites. One-pot restriction-ligation reaction, transformation into Escherichia coli and plating on selective media yields >98% recombinant plasmidscontaining the gene of interest fused to the His6-tag at the C-terminus or, if required, genes that do not contain any vector-encoded sequences.KEYWORDS:expression in E. coli • Golden Gate • pET vectors • sacB • seamless cloningRapid advances in next-generation sequencing technologies have generated vast amounts of genomic sequence data that representa rich source for bioprospecting for enzymes for industrial biotechnology applications. In order to speed up enzyme discovery andfunctional analysis, tools and protocols for high-throughput cloning are necessary. A variety of cloning strategies have been developedfor creating protein expression constructs for structural and functional studies [1]. The Golden Gate cloning strategy has been shownto be incredibly powerful in cloning DNA fragments with high efficiency [2–5]. It relies on the use of Type IIs restriction enzymes thatcleave DNA outside of their recognition site, providing unique cohesive ends that enable directional and seamless cloning of the gene ofinterest. The Golden Gate protocol allows for convenient and rapid cloning in a single-tube, one-step coupling restriction digestion andligation [2].Vectors from the pET System (Novagen) are a popular choice for the heterologous expression of genes in Escherichia coli undercontrol of the T7lac promoter for applications that require high protein yields. Here we present the modification of one of these vec-tors, pET29a(+), for use with the Golden Gate cloning strategy. Two vectors were generated and designated pET29:SacB-BsaI andpET29:SacB-SapI. Both contain a negative selection marker in place of the multiple cloning site of pET29: the Bacillus subtilis sacBgene, expressed from its native promoter and flanked by BsaI or SapI restriction sites (Figure 1A).The sacB gene from B. subtilis encodes levansucrase, an enzyme secreted in the culture medium after induction by sucrose. Levansu-crase catalyzes the hydrolysis of sucrose and synthesis of the branched fructose polymer known as levan. Expression of sacB in E. coliand other Gram-negative bacteria is lethal in the presence of sucrose, probably due to the accumulation of levans in the periplasm [6–8].In B. subtilis, the upstream region of the sacB gene contains the promoter and the regulatory sequence sacR which, when cloned to-gether with sacB, promote its efficient expression in E. coli [9]. We thus amplified the 1903-bp region from B. subtilis containing 445 bp ofupstream regulatory sequences, the sacB gene and the terminator sequence, and inserted it in the pET29, where it replaced the multiplecloning site in the opposite orientation to the T7lac promoter [10]. We found that this orientation resulted in efficient sacB expressionand counterselection.All molecular biology reagents were obtained from New England Biolabs and used following the manufacturer’s protocols, unlessstated otherwise. All PCR reactions were performed with the Phusion R© High-Fidelity PCR Master Mix with HF Buffer. PCR products weregel-purified or PCR-purified with Monarch R© PCR & DNA Cleanup Kit. All ligation reactions were performed with the high-concentrationT4 DNA ligase. Restriction digestion protocols were performed with restriction enzymes: NdeI, XhoI, DpnI, SapI and BsaI-HFv2. QiaQuickPlasmid Kit (Qiagen) was used for plasmid DNA preparation. All primers were synthesized by Eurofins Genomics and are listed in Table 1.Vol. 69 No. 6 C© 2020 John M Ward www.BioTechniques.com1BenchmarkSingle-tube reaction100 ng vector100 ng purified insert1 μl Bsal-HFv21 μl T4DNA ligase1 μl T4DNA ligase bufferX μl ddH2OTotal 10 μl6 HisT7 terminatorf1OriKanROriBom RopLaclFinal constructInsert-BsalInsert-SaplLac operator-RBST7 promoter15–21 bp15–21 bp15–21 bp15–21 bpGTAGTA5’ AAAGGTCTCGGGTG5’ AAAGCTCTTCGGTGTTCTCTGGAAA 5’GCTTCTCGAAA 5’T7 terminatorSapl/Bsal6 HisSapl/BsalSacBLac operator-RBST7 promoterSapl6× HisBsalSaplBsal6× HisNdelNdelRBSRBSXholXhol5’ T T T T TTTTTT3’ AAA A AA A A AAC CC C C CC C C CC C CC CC GGGGGGG GGGGGGGG G5’ T T T T TTT TT3’ AAA A AA A AAC CC C C C C CC CCC CC CC GGG GGG GGGGGGGGG G............xx5’3’G GG G G G GGGTT T T T T T TTTTTCCC C CC C CCA5’3’G G GG G G GGTT T T TT TTTTTTCC C C CCCCAA AA AAA A AA AAA A AA A A AAAAApET29a:SacBFigure 1. One-pot cloning reaction with modified pET vector and a single insert. (A) BsaI and SapI restriction sites allow excision of sacB and result in4-base and 3-base overhangs, respectively, that direct the assembly. (B) Recognition sequences for SapI and BsaI are added via the PCR to the gene ofinterest. Complementary overhangs in the insert that direct the assembly are in bold, green and blue. (C) In the single-tube reaction, the sacB in thedestination vector is replaced with the gene of interest so that the ATG within the NdeI site (CATATG) is used as a start codon, putting the gene ofinterest in-frame with vector-encoded C-terminal His6-tag. In the final construct no amino acids are present between the protein of interest and theHis6-tag.Table 1. Primers used for vector modification.Primer Sequence (5′–3′)pET29-BsaI-F AAACATATGTATATCTCCTTCTTAAAGTTAAACAAAATTATTTCTAGpET29-BsaI-R AAAACTCGAGGGTCTCGCACCACCACCACCACCACTGAGsacB-BsaI-F AAACATATGTGAGACCGTCAATGCCAATAGGATATCGGCATTTTCsacB-BsaI-R AAAACTCGAGACATATACCTGCCGTTCACTATTATTTAGTGP3-F P-GCTTCCTCGCTCACTGACTCGCTGP3-R P-GGAAGTGCGCCTGATGCGGTATTTTCTCCTTACGpET29-SapI-F AAACATATGTATATCTCCTTCTTAAAGTTAAACAAAATTATTTCTAGpET29-SapI-R AAAACTCGAGGCTCTTCGCACCACCACCACCACCACTGAGsacB-SapI-F AAACATATGGGAAGAGCGTCAATGCCAATAGGATATCGGCATTTTCsacB-SapI-R AAAACTCGAGACATATACCTGCCGTTCACTATTATTTAGTGNdeI and XhoI restriction sites are in bold; BsaI and SapI restriction sites are underlined. Additional nucleotides introduced during the cloning proce-dure are in gray.E. coli Nova Blue cells from Novagen were made chemically competent using the standard calcium chloride protocol. The workingconcentration for kanamycin was 50 μg/ml.The B. subtilis sacB coding sequence, complete with its signal peptide and regulatory sequences (GenBank CP051860.1: 1746670–1748572, 1903 bp), was previously amplified from strain 168 genomic DNA and cloned into a customized vector. To construct pET29:SacB-BsaI, sacB and pET29a(+) were first PCR amplified using the primers sacB-BsaI-F/sacB-BsaI-R and pET29-BsaI-F/pET29-BsaI-R, re-Vol. 69 No. 6 C© 2020 John M Ward www.BioTechniques.com2spectively. PCR fragments were then digested with NdeI and XhoI restriction enzymes and ligated to form the final vector. To constructpET29:SacB-BsaI, the SapI restriction site was deleted in the pET29a(+) by changing the sequence from GCTCTTC to GCACTTC. 5′phosphorylated primers P3-F and P3-R were used to do this in a routine PCR reaction with 20 cycles. The PCR reaction product wasdigested with DpnI to remove the methylated template vector and thus reduce the background. PCR products were gel-purified, ligatedto form circular vectors and transformed into chemically competent E. coli Nova Blue cells. The vector with deleted SapI restriction sitewas PCR amplified using the primers pET29-SapI-F and pET29-SapI-R. The PCR product was digested with NdeI and XhoI and ligated tosacB that was amplified with sacB-SapI-F and sacB-SapI-R and digested with the same restriction enzymes.A functional sacB gene is a prerequisite for efficient counter selection; therefore after ligation and transformation, individual colonieswere tested for their growth on Luria–Bertani medium supplemented with kanamycin, in the presence or the absence of 10% sucrose. Vec-tors were isolated from transformants that were resistant to kanamycin and sensitive to sucrose. Both constructed vectors, pET29:SacB-BsaI and pET29:SacB-SapI, were further verified by DNA sequencing and their functionality was initially tested by cloning and expressionof eGFP in E.coli BL21 (DE3) (data not shown).To clone the genes of interest in the modified vectors, primers generally contained a minimum of 15 (preferably 18–21) nucleotidescomplementary to the sequence of interest with, when possible, a GC content of about 50%. The following overhangs were added tothe primers: Forward 5′-AAAGGTCTCTTATG-3′ and Reverse 5′-AAAGGTCTCGGGTG-3′ for cloning in pET29:SacB-BsaI; and Forward 5′-AAAGCTCTTCGATG-3′ and Reverse 5′- AAAGCTCTTCGGTG-3′ for cloning with pET29:SacB-SapI. Overhangs contained restriction sitesand were flanked by three ‘spacer’ nucleotides at the 5′ end to allow for efficient digestion (Figure 1B). In our case, the choice of thethree- and four-base overhangs was restricted by the vector sequence, whereas in multipart assemblies junctions can often be arbitrarilychosen [11,12]. To avoid the vector-encoded C-terminal Hisx6 fusion, a translation stop codon could be included in the insert via the primer.Genes were amplified using the standard PCR procedure and gel-purified before being used in the one-pot cloning reaction.The one-pot cloning reaction mixture consisted of 100 ng vector, 100 ng amplified DNA fragments, 1 μl restriction enzyme, 1 μl T4DNA ligase and 1 μl 10× T4 DNA ligase buffer in a total reaction volume of 10 μl (Figure 1C). The mixture was incubated at 37◦C for30 min. 2 μl of each reaction was added to 20 μl of Nova Blue E. coli chemically competent cells and incubated on ice for 30 min. Thecells were heat shocked at 42◦C for 60 s, chilled on ice for 5 min, then recovered in 200 μl of SOC for 1 h at 37◦C. Cells were plated onLuria–Bertani agar supplemented with kanamycin and 10% v/v sucrose (sterile sucrose solution was prepared by filtering and added towarm Luria–Bertani agar before pouring into plates). Typically >98% of clones positive for the desired recombinant vector were obtainedafter transformation. This high efficiency eliminated the need for colony screening and allowed for a single colony per construct to bepicked and verified by DNA sequencing.The method described has been extensively used in our laboratory to construct and expand our biocatalysis enzyme toolbox with awide range of enzymes. It does not require very long primers or commercial kits. Cloning is directional and the protocol has proved to befast, reliable and efficient; in a great majority of the clones, only the desired product is present. One-pot restriction digestion/ligation iscarried out in a short time (30 mins) and the ligated DNA is immediately transformed. Expression-ready clones are available the next dayafter growth of the transformed cells. To date, using the adapted vectors, we have effectively cloned and expressed in E. coli hundredsof genes with diverse origins (from metagenomic DNA and individual genomes) and complexity, with GC content ranging from 35 to 73%and gene lengths between 0.3 and 2.5 kb. Examples of panels of recombinant enzymes constructed in this way include enzyme classessuch as transaminases from a drain metagenome [13], ene-reductases also from a drain metagenome [14] and epoxide hydrolases minedfrom sequenced bacterial genomes [15], demonstrating the versatility of the protocol.Author contributionsD Dobrijevic and L Nematollahi conceived the experiments; D Dobrijevic designed and performed the experiments and analyzed the data;D Dobrijevic and L Nematollahi wrote the manuscript. All authors edited and approved the final manuscript. Funding was from grants toD Dobrijevic, J Ward and H Hailes.AcknowledgmentsThe authors acknowledge the UKRI Research Councils BBSRC and EPSRC for financial support to D Dobrijevic and J Ward.Financial & competing interests disclosureD Dobrijevic is supported by the BBSRC grant BB/L007444/1 and the EPSRC grant EP/S024883/1. Other support for J Ward and H Hailesis from the BBSRC grant BB/N01877X/1. The authors have no other relevant affiliations or financial involvement with any organization orentity with a financial interest in or financial conflict with the subject matter or materials discussed in the manuscript apart from thosedisclosed.No writing assistance was utilized in the production of this manuscript.Vol. 69 No. 6 C© 2020 John M Ward www.BioTechniques.com3BenchmarkOpen accessThis article is distributed under the terms of the Creative Commons Attribution License 4.0 which permits any use, distribution,and reproduction in any medium, provided the original author(s) and the source are credited. To view a copy of the license, visithttp://creativecommons.org/licenses/by/4.0/.ReferencesPapers of special note have been highlighted as: •• of considerable interest1. Celie PHN, Parret AHA, Perrakis A. Recombinant cloning strategies for protein expression. Curr. Opin. Struct. Biol. 38, 145–154 (2016).2. Engler C, Kandzia R, Marillonnet S. A one pot, one step, precision cloning method with high throughput capability. PLoS ONE 3(11), e3647 (2008).•• First description of the Golden Gate cloning strategy that allows highly efficient directional assembly of multiple DNA fragments.3. Engler C, Gruetzner R, Kandzia R, Marillonnet S. Golden Gate shuffling: a one-pot DNA shuffling method based on Type IIs restriction enzymes. PLoS ONE 4(5), e5553 (2009).4. Weber E, Engler C, Gruetzner R, Werner S, Marillonnet S. A modular cloning system for standardized assembly of multigene constructs. PLoS ONE 6(2), e16765 (2011).•• Modular cloning system based on Golden Gate that allows assembly of multigene constructs from sets of pre-made standardized genetic modules.5. Iverson SV, Haddock TL, Beal J, Densmore DM. CIDAR MoClo: improved MoClo assembly standard and new E. coli part library enable rapid combinatorial design for synthetic and traditionalbiology. ACS Synth. Biol. 5(1), 99–103 (2016).•• Publicly available library of standardized DNA parts and assembly protocols for use in E. coli based on Golden Gate.6. Ried JL, Collmer A. An nptI-sacB-sacR cartridge for constructing directed, unmarked mutations in Gram-negative bacteria by marker exchange-eviction mutagenesis. Gene 57(2–3),239–246 (1987).7. Steinmetz M, Le Coq D, Aymerich S, Gonzy-Tréboul G, Gay P. The DNA sequence of the gene for the secreted Bacillus subtilis enzyme levansucrase and its genetic control sites. Mol. Gen.Genet. 200(2), 220–228 (1985).8. Gay P, Le Coq D, Steinmetz M, Berkelman T, Kado CI. Positive selection procedure for entrapment of insertion sequence elements in Gram-negative bacteria. J. Bacteriol. 164(2), 918–921(1985).9. Gay P, Le Coq D, Steinmetz M, Ferrari E, Hoch JA. Cloning structural gene sacB, which codes for exoenzyme levansucrase of Bacillus subtilis: expression of the gene in Escherichia coli.J. Bacteriol. 153(3), 1424–1431 (1983).10. Wu SS, Kaiser D. Markerless deletions of pil genes in Myxococcus xanthus generated by counterselection with the Bacillus subtilis sacB gene. J. Bacteriol. 178(19), 5817–5821 (1996).11. Vladimir P, Ong J, Kucera R et al. Optimization of Golden Gate assembly through application of ligation sequence-dependent fidelity and bias profiling. bioRxiv. 322297 (2018).12. Potapov V, Ong JL, Langhorst BW et al. A single-molecule sequencing assay for the comprehensive profiling of T4 DNA ligase fidelity and bias during DNA end-joining. Nucleic AcidsRes. 46(13), e79 (2018).13. Leipold L, Dobrijevic D, Jeffries JWE et al.The identification and use of robust transaminases from a domestic drain metagenome. Green Chem. 21(1), 75–86 (2019).14. Dobrijevic D, Benhamou L, Aliev AE et al. Metagenomic ene-reductases for the bioreduction of sterically challenging enones. RSC Adv. 9(63), 36608–36614 (2019).15. Stojanovski G, Dobrijevic D, Hailes HC, Ward JM. Identification and catalytic properties of new epoxide hydrolases from the genomic data of soil bacteria. Enzyme Microb. Technol. 139,109592 (2020).Vol. 69 No. 6 C© 2020 John M Ward www.BioTechniques.com4

pET expression vector customized for efficient seamless cloning

https://discovery.ucl.ac.uk/10114537/1/Hailes_pET%20expression%20vector%20customized%20for%20efficient%20seamless%20cloning_VoR.pdf

pET expression vector customized for efficient seamless cloning

Abstract

Similar works

Full text

Available Versions

UCL Discovery