Members of the genus Acinetobacter are typical opportunistic bacterial pathogens that can survive for a long term even on inanimate surfaces. Acinetobacter species have natural and acquired antibiotic resistance mechanisms that provide resistance against a broad range of antimicrobial agents. Between April 2010 and March 2011, 6 clinical Acinetobacter sp. strains were isolated from expectoration or aspiration sputum samples in a local medical treatment-type hospital in Osaka prefecture. The antibiotic susceptibility breakpoint test showed that all the 6 isolates were ciprofloxacin-resistant. Strain AHU-70, which was identified as A.baumannii by 16S rRNA sequencing and polymerase chain reaction detection of the blaOXA-51-like gene, showed high levels of resistance to ciprofloxacin by the minimum inhibitory concentration (MIC) test. Preliminary research in Japan, based on nationwide susceptibility surveillance of ciprofloxacin against A.baumannii isolates showed that approximately 90% of the isolates were ciprofloxacin-susceptible. Given these results, further strain level identification of isolates is required to determine whether resistance to ciprofloxacin is an overall trait of these bacteria in the sampled local area or is restricted to a specific strain within particular hospitals

Aino Gakuin College

Aino Hospital

Department of Nursing, Faculty of Niursing and Rehabilitation,Aino University

Department of Nursing, Faculty of Nursing and Rehabilitation,Aino University

Hiroyuki ITAGAKI

Shiho SHIRAKI

Tomoko NAKADA

Yuji NAKADA

Members of the genus Acinetobacter are typical opportunistic bacterial pathogens that can survive for a long term even on inanimate surfaces. Acinetobacter species have natural and acquired antibiotic resistance mechanisms that provide resistance against a broad range of antimicrobial agents. Between April 2010 and March 2011, 6 clinical Acinetobacter sp. strains were isolated from expectoration or aspiration sputum samples in a local medical treatment-type hospital in Osaka prefecture. The antibiotic susceptibility breakpoint test showed that all the 6 isolates were ciprofloxacin-resistant. Strain AHU-70, which was identified as A.baumannii by 16S rRNA sequencing and polymerase chain reaction detection of the blaOXA-51-like gene, showed high levels of resistance to ciprofloxacin by the minimum inhibitory concentration (MIC) test. Preliminary research in Japan, based on nationwide susceptibility surveillance of ciprofloxacin against A.baumannii isolates showed that approximately 90% of the isolates were ciprofloxacin-susceptible. Given these results, further strain level identification of isolates is required to determine whether resistance to ciprofloxacin is an overall trait of these bacteria in the sampled local area or is restricted to a specific strain within particular hospitals.6KJ00008182399PShort reoprtdepartmental bulletin pape

NAKADA, Yuji

SHIRAKI, Shiho

ITAGAKI, Hiroyuki

NAKADA, Tomoko

Aino University Institutional Repository / 藍野大学学術機関リポジトリ

 AINO  JOURNAL,  Vol.  10,  2011,  pp.  23  -26Short report Characterization of Acinetobacter clinical isolates Yuji  NAKADAShiho SHIRAKIHiroyuki  ITAGAKITomoko NAKADAProfessor,tation,Department  of  Nursing, Faculty Aino UniversityUndergraduate student,and Rehabilitationof Nursing and  Rehabili-Department of  Nursing,, Aino UniversityMedical technologist,Part-time lecturer,Aino Hospital Aino Gakuin College Faculty of  NursingAbstractMembers of the genus Acinetobacter are typical opportunistic bacterial pathogens that can survive for a long term even on inanimate surfaces. Acinetobacter species have natural and acquired antibiotic resistance mechanisms that provide resistance against a broad range of antimicrobial agents. Between April 2010 and March 2011, 6 clinical Acinetobacter sp. strains were isolated from expectoration or aspiration sputum samples in a local medical treatment-type hospital in Osaka prefecture. The antibiotic susceptibility breakpoint est showed that all the 6 isolates were ciprofloxacin-resistant. Strain AHU-70, which was identified as A. baumannii by  16S rRNA sequencing and polymerase chain reaction detection of the  blaOXA-51-like gene, showed high levels of resistance to ciprofloxacin by the minimum inhibitory concentration (MIC) test. Preliminary research in Japan, based on nationwide susceptibility surveillance of ciprofloxacin against A. baumannii isolates showed that approximately 90% of the isolates were ciprofloxacin-susceptible. Given these results, further strain level identification of isolates is required to determine whether resistance to ciprofloxacin is an overall trait of these bacteria in the sampled local area or is restricted to a specific strain within particular hospitals. INTRODUCTIONKey  words  : Acinetobacter, Acinetobacter species constitute prevalent op-portunistic human pathogens that cause acute pneumonia, meningitis, and septicemia in immuno-compromised patients (Humphreys et  al., 1996). They are widely distributed in nature and in hospital environments such as intensive care units, due to their ability for long-term survival even on inanimate surfaces (Kappstein et al., 2000). A. baumannii, A. calcoaceticus, A. haemo-lyticus, A. johnsonii, A. junii, A.  lwoffii, A.  parvus,  A. radioresistens, A. schindleri, A. ursingii, A. genomic species  3,  13TU, 10, and 11 have been isolated from human specimens (Dortet et  al., 2006). Particularly, A. baumannii is most frequently isolated from humans and also appears to be the Acinetobacter species with the greatest clinical importance. Identification of Acineto-bacter species on the bases of abbreviatedsusceptibility, ciprofloxacinphenotypic tests is difficult, and genetic methods such as standard DNA-DNA hybridization (Bouvet and Grimont, 1986) and sequencing of the 16S rRNA gene (Ibrahimet al., 1997) or the 16-23S rRNA intergenic spacer region (Lee et al., 2011) have been proposed. It is also known that Acinetobacter species have natural and acquired antibiotic resistance mechanisms that provide increasing resistance against a broad range of antimicrobial agents (Lee et  al., 2011). In Japan, Acinetobacter species for which minimum inhibi-tory concentrations (MICs) of imipenem (IMP), amikacin (AMK), and ciprofloxacin (CPFX) are  16  g/mL,  > 32  g/mL, and 4  g/mL,  respec-tively, are defined as multidrug-resistant  Acine-tobacter species (MDRA), according to the Infectious Diseases Control Law in correspond-ence to the increased hospital infection by MDRA (Yuji et  al., 2011).23MATERIALS AND METHODSAINO JOURNAL,Bacterial isolates and growth conditions Between April 2010 and March 2011, clinical Acinetobacter sp. strains were isolated from expectoration or aspiration sputum samples of patients with different infections in a medical treatment-type hospital (approximately 1,000 beds) in Osaka prefecture. Genus classification of the strains was performed using the MicroScan WalkAway Plus (Siemens, Germany) fully auto-mated instrument. A. baumannii ATCC17978 is a standard strain for which the complete genomic sequence is available (Michael et al., 2007); this strain was isolated from a 4-month-old infant with meningitis. All the strains were cultured at 37°C in Mueller-Hinton (MH; Oxoid, USA) medium supplemented with antibiotics when appropriate. DNA techniques DNA purification and other DNA manipulations were conducted as previously described (Nakada and Itoh, 2002; Sambrook et  al., 2001). A poly-merase chain reaction (PCR) was performed with KOD-plus DNA polymerase (Toyobo Biochemi-cals, Japan) in a GeneAmp PCR System 2700 thermal cycler (Applied Biosystems, USA) under the reaction conditions recommended by the supplier. Fragment size of the PCR products was determined by 1.5% agarose gel electrophoresis.Vol. 10, 2011by using a BLAST program.Detection  of  the  blaOXA-51-like gene The  blaOXA-51-like gene, which appears to be intrinsic to A. baumannii (Woodford et  al.  , 2006), was detected by PCR by using the primer pair of OXA-51-likeF and OXA-51-likeR (Table 1). PCR conditions were as follows: 94°C for 3 min; 28 cycles of 94°C for 1  min, 60°C for 1  min, and 68°C for 1  min; and a final extension at 68°C for 4  min.Antibiotic susceptibility test Antimicrobial breakpoint ests were conducted by FALCO biosystems Ltd. by using the Micro-Scan Walk Away Plus (Siemens, Germany) fully automated instrument. Isolates were determined to be susceptible  (S), intermediate (I), or resistant (R) according to the antibiotic breakpoint guide-lines of the Clinical and Laboratory Standards Institute (CLSI) for Acinetobacter sp. (CLSI, 2006).  The MICs for IMP, AMK, and CPFX, which are used to define MDRA in Japan, were also determined by the standard broth dilution method according to the guidelines of the CLSI. Over-night cultures of each Acinetobacter sp. strain were diluted in saline to an optical density of 0.1 at 600 nm of (approximately 1  x 108 CFU/mL), and a portion of the adjusted cell suspension  (-105cells) was inoculated on the MH medium containing antibiotics as indicated. The cell cultures were then incubated overnight at  37°C  .Nucleotide sequencing of the 16S  rRNA gene The  16S rRNA gene of the AUH-70 strain was amplified by PCR with a universal primer pair of UFPL and URPL (Lipuma et  al.  , 1999; Table 1). PCR conditions were as follows: 94°C for 3  min; 30 cycles of 94°C for 1 min, 55°C for 1  min, and 68°C for 1.5  min; and a final extension at 68°C for 4  min. The resultant approximately  1.5-kbp fragment was purified using a PCR Purification Kit (WAKO, Japan), and its nucleotide sequence was deter-mined using the  ABI3130 DNA sequencer and a Big-Dye Terminator Sequencing Kit (Applied Biosystems, USA). Sequence assembly was per-formed using ATGC version 5.0 (Genetyx Corporation, Japan), and the resultant sequence was compared with those in the NCBI databaseTable 1 RESULTSIsolated strains Within one year, 6 patients developed Acineto-bacter sp. infection, and clinical isolates, including AUH-70 strain, were obtained from expectoration or aspiration sputum samples (Table 2). The patients included those in old-age chronic stage wards (A, B) and specific disease wards (C).Identification of the AUH-70 strain The 16S rRNA genomic region containing approximately 1500 nucleotides was amplified (Fig. 1), and 1406  bp sequence data were obtained by direct sequencing. Alignment and comparison PCR primers and their target genes and amplicon sizesPrimer Oligonucleotide sequence  (5' -3'  ) Target Amplicon size (bp)UFPLURPLOXA-51-likeFOXA-51-likeRAGTTTGATCCTGGCTCAGGGTTACCTTGTTACGACTTTAATGCTTTGATCGGCCTTGTGGATTGCACTTCATCTTGG16SrRNAgene blaOXA-51-like1492*353*Corresponding to positions 9-1500 in the Escherichia  coli numbering system24NAKADA et  al  :Table 2 SpecimensCharacterization of Acinetobacter clinical isolatesand antimicrbial breakpoints   of Acinetobactersp. isolates bpIsolate code Hospital Breakpoint(Strain) wardSpecimens PIPC CAZ  IPM  MINO AMK CPFXE41 A aspiration sputum R S S      S S RN21 B expectoration S S S      S S RC41 C aspiration sputum R S S      S S RC42 C aspiration sputum R S S      S S RN22 (AUH-70) B aspiration sputum S S S      S S RC43 C aspiration sputum S S S      S S RA and B: old-age chronic stage wards, C:PIPC: piperacillin, CAZ:  ceftazidime,  IPM:CPFX: ciprofloxacin.specific disease wards. imipenem, MINO: minocycline,  AMK:Table 3 amikacin,1500500400300200100M 1 2MICs  of  A.  baumannii ATCC17978 and the AUH-70strainLane 1: 16S  rRNA gene, lane 2:  bla0XA-51-like g ne, M: 100-bp DNA marker Fig. 1 PCR results of amplified fragments of the 16S rRNA       gene and  bla0XA-51-like gene from the AUH-70 strainof this region with the A. baumannii ATCC17978 16S rRNA gene which is positioned from nt 53 to nt 1458 (Michael et al., 2007), indicated complete homology. Moreover, sequence similarity with the equivalent 16S rRNA gene region of A.  baumannii  UMB001, A. baumannii ABNIH1, A. baumannii  ATCC19606, and A. baumannii AYE was greater than 99.9%. Furthermore, PCR detection of the  bla0XA-51-like gene, which appears to be intrinsic to A. baumannii, was positive (Fig. 1). These results suggest that the AUH-70 strain was A.  baumannii.Antibiotic susceptibility The antimicrobial breakpoint test showed that all 6 isolates were CPFX-resistant; moreover, of these 6 isolates, 3 were piperacillin-resistant (Table 2). Furthermore, the resultant of MIC test showed that the AUH-70 strain was highly resistant to CPFX (Table 3). On the other hand, IMP and AMK was still effective to the clinicallyStrainMICs  (ug/mL)Imipenem  Amikacin Ciprofloxacin A.A.?????0.250.250.50.50.12532isolated AUH-70 strain, as was ATCC17978 standard strain.DISCUSSIONA.  baumannii In this study, we examined the antibiotic susceptibility of Acinetobacter sp. isolates  ob-tained from a medical treatment-type hospital in Osaka prefecture. Within one year, 6 patients developed Acinetobacter sp. infection, and all isolates obtained from these patients showed CPFX resistance. CPFX is a fluoroquinolone-type antibiotic that exerts its antibacterial effects by inhibiting DNA gyrase and topoisomerase IV enzymes, which are necessary for separating bacterial DNA, thereby inhibiting cell division. Nationwide susceptibility surveillance studies of CPFX against A. baumannii isolated from pa-tients between 2001 and 2005 (Yamaguchi et al, 2008) and between 2006 and 2010 (http: //www. kansensho. or. jp/mrsa/index. html) showed that approximately 90% of the collected isolates were susceptible to this antibiotic. These results suggest 2 possibilities. One is the rapid evolution of the CPFX-resistant Acinetobacter sp. in the sampled local area, and the other is the develop-ment of a few CPFX-resistant strains in a particular hospital. In the current study, the number of affected patients in specific wards, and the limited variation in antibiotic susceptibility patterns, seem to support the likelihood of expansion of a few resistant strains in the hospital; however there is no conclusive evidence for this25AINO JOURNAL,hypothesis. From the standpoint of nosocomial infection control, a surveillance study involving strain identification by REP-PCR, VNTR, or PFGE (Pourcel et al, 2011) is required.REFERENCESBouvet PJM, Grimont PAD: Taxonomy of the genus Acineto-      bacter with the recognition of Acinetobacter bauman-       nii sp. nov.,  Acinetobacter haemolyticussp. nov.,       Acinetobacter johnsonii sp. nov., and Acinetobacter       junii sp. nov. and emended descriptionof Acineto-      bacter calcoaceticus and Acinetobacter  lwofii. Int. J.       Syst.  Bacteriol. 36: 228-240, 1986CLSI: Performance standards for antimicroibial susceptibility       testing: sixteenth informational supplement.  M100-     S16, 16th ed. Clinical and Laboratory Standards       Institute, Wayne, PA. 2006 Dortet L, Legrand P, Soussy CJ, Cattoir V: Bacterial identi-      fication, clinical significance, and antimicrobialsuscep-      tibilities of Acinetobacter  ursingii and Acinetobacter       schindleri, two frequently misidentifiedopportunistic       pathogens. J. Clin. Microbiol. 44: 4471-4478, 2006 Humphreys H Towner KJ: Impact of Acinetobacter spp. in       intensive care units in Great Britain and Ireland. J.      Hosp. Infect. 37: 281-286, 1996 Ibrahim A, Gerner-Smidt P, Liesack W: Phylogenetic relation-      ship of the twenty-one DNA groups of the genus       Acinetobacter as revealed by  16S ribosomalDNA       sequence analysis.  Int. J. Syst. Bacteriol. 47: 837-841,      1997 Kappstein I, Grundmann H, Hauer T, Niemeyer C: Aerators as       a reservoir of Acinetobacter  junii: an outbreakof       bacteraemia in paediatric oncology patients. J. Hosp.      Infect. 44: 27-30, 2000 Lee K, Yong D, Jeong SH, Chong Y: Multidrug-resistant       Acinetobacter spp. increasinglyproblematic nosoco-      mial pathogens. Yonsei Med J. 52: 879-891, 2011 Lee Y, Lee J, Jeong SH, Lee J, Bae  IK, Lee K: Carbapenem-non-      susceptible Acinetobacter  baumannii of sequence type       92 or its single-locus variants with a G428T substitu-      tion in zone 2 of the rpoB gene. J AntimicrobVol. 10, 2011      Chemother. 66: 66-72, 2011 Lipuma JJ, Dulaney BJ, Mcmenamin JD, Whitby PW, Stull TL       Coenye T Vandamme P: Development of rRNA-     based PCR assays for identification of Burkholderia  cepacia complex isolates recovered from custic       fibrosis patients, J. Clin. Microbiol. 37: 3167-3170, 1999 Michael GS, Tara AG, Stefan P, John JM, Nicholas O, Mark G.,       Michael S: New insights into Acinetobacter baumannii      pathogenesis revealed by high-density pyrosequenc-      ing and transposon mutagenesis. Genes Dev. 21:      601-614, 2007 Nakada Y, Itoh Y: Characterization and regulation of the gbuA       gene, encoding guanidinobutyrase in the arginine       dehydrogenase pathway of Pseudomonas aeruginosa  PAO1. J. Bacteriol. 184: 3377-3384, 2002 Pourcel C, Minandri F, Hauck Y, D'Arezzo S, Imperi F,       Vergnaud  G, Visca P: Identification of variable-      number tandem-repeat (VNTR) sequences in       Acinetobacter baumannii and interlaboratory valida-      tion of an optimized multiple-locus VNTR analysis       typing scheme. J. Clin. Microbiol. 49: 539-548, 2011 Sambrook J, Fritsch EF, Maniatis T: Molecular cloning: a       laboratory manual, 3nd ed. Cold Spring Harbor      Laboratory, Cold Spring Harbor, N. Y. 2001 Woodford N, Ellington MJ, Coelho JM, Turton JF, Ward ME,       Brown  S, Amyes  SG, Livermore DM: Multiplex PCR       for genes encoding prevalent OXA carbapenemases       in Acinetobacter spp.  Int. J. Antimicrob. Agents. 27:      351-353, 2006 Yamaguchi K, Ishii Y, Yamanaka K, Watanabe N, Uehara N,       Kaku M, Okabe T, Ito K, Nagasawa M, Baba H,      Ichiyama  S, Kurokawa Y, Negayama K, HirakataY:      Nationwide susceptibility surveillance of ciprofloxacin      and various parenteral antimicrobials against bacteria       isolated from patients with severe infections—third       ciproxan injection special survey (2005). Jpn. J.       Antibiot. 61: 241-268, 2008 Yuji K, Oiso  G, Matsumura T, Murashige N, Kami M: Police       investigation into multidrug-resistant Acinetobacter       baumannii outbreak in Japan. Clin. Infect.Dis. 52: 421,      201126

Characterization of Acinetobacter clinical isolates

https://aino.repo.nii.ac.jp/?action=repository_action_common_download&item_id=376&item_no=1&attribute_id=21&file_no=1

Characterization of Acinetobacter clinical isolates

Abstract

Similar works

Full text

Available Versions

Aino University Institutional Repository / 藍野大学学術機関リポジトリ