The yeast Wickerhamomyces anomalus has been proposed for many biotechnological applications in the food industry. However, a number of opportunistic pathogenic strains have been reported as causative agents of nosocomial fungemia. Recognition of potentially pathogenic isolates is an important challenge for the future commercialization of this yeast. The isolation of W. anomalus from different matrices and, recently, from mosquitoes, requires further investigations into its circulation in humans. Here we present a qPCR protocol for the detection of W. anomalus in human blood samples and the results of a screening of 525 donors, including different classes of patients and healthy people

Bazzocchi, C

BOZIC, JOVANA

Capone, A

Epis, S

FAVIA, GUIDO

Martin, E

Novati, S

Paolucci, M

RICCI, Irene

Valzano, M

Archivio istituzionale della ricerca - Università di Camerino

New Microbiologica, 38, 577-581, 2015A rapid qPCR method to investigate  the circulation of the yeast  Wickerhamomyces anomalus in humansSara Epis1, Aida Capone2, Elena Martin1, Michela Paolucci3, Chiara Bazzocchi1,  Matteo Valzano2, Jovana Bozic2, Stefano Novati4, Guido Favia2, Irene Ricci21Department of Veterinary Sciences and Public Health, University of Milan, Milan, Italy; 2School of Biosciences and Veterinary Medicine, University of Camerino, Camerino, Italy; 3Unit of Microbiology, St. Orsola-Malpighi, University Hospital, Bologna, Italy; 4Fondazione IRCCS Policlinico San Matteo, University of Pavia, Pavia, ItalyCorresponding authorIrene RicciSchool of Biosciences & Veterinary MedicineUniversity of CamerinoVia Gentile III da Varano - 62032 Camerino (Mc), ItalyE-mail: irene.ricci@unicam.itSuMMARyReceived December 12, 2014 Accepted July, 24 2015The yeast Wickerhamomyces anomalus has been proposed for many biotechnological applications in the food industry. However, a number of opportunistic pathogenic strains have been reported as causative agents of no-socomial fungemia. Recognition of potentially pathogenic isolates is an important challenge for the future com-mercialization of this yeast. The isolation of W. anomalus from different matrices and, recently, from mosquitoes, requires further investigations into its circulation in humans. Here we present a qPCR protocol for the detection of W. anomalus in human blood samples and the results of a screening of 525 donors, including different classes of patients and healthy people.KEY WORDS: Wickerhamomyces anomalus, opportunistic pathogen, fungemia, qPCR, mosquito vectors.Wickerhamomyces anomalus (also designated as Pichia anomala, Hansenula anomala and Candida pelliculosa) is an ascomycete yeast well known for its antimicrobial properties, that have led to this microorganism being consid-ered a biocontrol agent (Walker, 2011). Some examples of applications of W. anomalus are: in food/feed biopreservation (Olstorpe and Pas-soth, 2011), as a probiotic additive (Zuo et al., 2013) and as a volatile aroma enhancer in wine making (Swangkeaw et al., 2009). This yeast has been isolated from different habitats or ma-trices like food and feed systems (Walker, 2011) and even from insects (Toki et al., 2012, Ricci et al., 2011a). The identification of antimicrobi-al W. anomalus strains in Anopheles and Aedes mosquitoes have led this yeast being proposed also in the biocontrol of malaria (Cappelli et al., 2014, Ricci et al., 2011b) and other mosqui-to-borne diseases (Ricci et al., 2011a).With regard to food safety aspects, W. anomalus is classed at biosafety level 1 by the European Food Safety Authority (De Hoog, 1996). In ad-dition, there are no reports in the literature on hazardous mycotoxin formation or allergic re-actions to the spores from this yeast. However, a number W. anomalus strains have been isolated from humans, raising the possibility that this yeast is an emerging opportunistic pathogen (Hazen, 1995, Kalkanci et al., 2010). In particu-lar, reports over the last decades have highlight-ed an increase in nosocomial yeast bloodstream infections, particularly pediatric outbreaks, due to uncommon species, including W. anomalus (Taj-Aldeen et al., 2014). W. anomalus infections have been reported in cancer patients (Thuler et al., 1997), infants and premature neonates (Aragão et al., 2001, Oliveira et al., 2014), and in S. Epis, A. Capone, E. Martin, M. Paolucci, C. Bazzocchi, M. Valzano, J. Bozic, S. Novati, G. Favia, I. Ricci578patients in surgical intensive care units (Kalen-ic et al., 2001). Possible explanations for the emergence of opportunistic pathogenic yeasts could be the increase in the number of patients at risk, such as immunocompromised persons, and the contribution of more sensitive diag-nostic methods. However, the reasons for the increased incidence of fungemia from uncom-mon pathogenic yeasts are not completely clear. Differentiating non-pathogenic strains from potential opportunistic pathogens is necessary for future biotechnological applications of W. anomalus (Passoth et al., 2011). In addition, the recent isolation of a W. anomalus strain from different mosquito species (Ricci et al., 2011a) has set a new alert, considering that hemato-phagous insects might play a role in spreading this microorganism.Here, we present a qPCR protocol for the detec-tion of W. anomalus using species-specific prim-ers previously designed (Huang et al., 2012), aimed at improving the current procedures for the rapid diagnosis of infections by this yeast. This optimized qPCR protocol was applied in a screening study to estimate the circulation of W. anomalus in human blood samples from different classes of patients (including immu-nocompromised) and from healthy donors.We carried out a retrospective analysis using previously collected blood samples. A total of 525 donors were examined by qPCR (Table 1): 243 blood samples, collected between January 2011 and November 2012 from critically ill pa-tients (adult and pediatric patients with suspi-cion of sepsis) admitted to the Intensive Care Units and Haematology Units (ICUs & HU) at the St. Orsola Malpighi University Hospital of Bologna; 183 blood samples, collected at the S. Matteo Hospital of Pavia in the context of an-other study, from 20 HIV, 61 HCV, and 19 HIV/HCV positive patients, and 83 healthy donors; 99 blood samples from additional 81 healthy donors collected at St. Orsola Malpighi, 10 ma-laria patients collected at Spedali Civili di Bres-cia (Institute for Infectious and Tropical Dis-eases, IITD) and 8 workers at the insectary of the University of Camerino (Unicam). All of the samples included in the present study were ob-tained and analysed in strict accordance with the current European and Italian rules on in-formed consent.The results of this screening for W. anomalus (Wa) in blood samples required the develop-ment of a highly specific and sensitive qPCR assay. For the protocol optimization 12 yeast isolates (eight representing W. anomalus; four representing other yeast species) were used as control strains: WaF17.12, WaM9.11, Candida sp. and Pichia sp. isolated from the malaria vec-tor mosquito An. stephensi (Ricci et al., 2011b); the environmental strains WaATCC 996603 and WaUM3 (Polonelli et al., 1997), Saccaromyces cerevisiae ATCC 2601 and Williopsis saturnus var. mrakii (Guyard et al., 2002); four clinical isolates of W. anomalus from four neonates hospitalized in an intensive care unit (Kalkanci et al., 2010). In the qPCR standard curve set-up, a target sequence of 218 bp of b-tubulin TABLE 1 - Summary of the screening for Wickerhamomyces anomalus (Wa) in human blood samples.Human samples and health  or disease statusSamples origin Wa-qPCR assay results positive/totalCritically ill patients St. Orsola Malpighi/ICUs & HU, University Hospital of Bologna0/243* (36 pediatric cases;  207 adults cases)HIV positive patients S. Matteo, Hospital of Pavia 0/20HCV positive patients S. Matteo, Hospital of Pavia 1/61HIV/HCV positive patients S. Matteo, Hospital of Pavia 0/19Malaria patients Spedali Civili di Brescia/ IITD 0/10Donors exposed to mosquito  bites at insectaryUnicam 0/8Healthy blood donors S. Matteo, Hospital of Pavia 0/83Healthy blood donors St. Orsola Malpighi, University Hospital of Bologna0/81Total 1/525*All of these patients displayed at least two signs among the criteria of the systemic inflammatory response syndrome (Kaukonen et al., 2015).A rapid qPCR method to investigate the circulation of the yeast Wickerhamomyces anomalus in humans 579gene was amplified using the specific primers SpWanom-170F (5’TTATCCATCCACCAATTG3’) and SpWanom-374R (5’GGAACTAAGTTCA-CAGCTA3’) (Huang et al., 2012). The primers were previously tested against yeast genomic DNAs from all of 12 isolates listed above. The expected amplicon was obtained from all eight W. anomalus isolates tested (two isolated from mosquito, two environmental and four clinical isolates), while no amplification was obtained from the other four yeast isolates, representing other species (Candida sp., Pichia sp., Saccaro-myces cerevisiae ATCC 2601 and Williopsis sat-urnus var. mrakii).To evaluate the amplification efficiency of the selected primers, the PCR product from WaF17.12 was cloned into a plasmid vector (pGEM-T Easy Vector System, Promega, Wis-consin, USA) and the amount of the recombi-nant plasmid was determined. We carried out a standard curve, using as DNA templates eight serial dilutions (10-1) of the recombinant plas-mid, corresponding to around 2.3x107 – 2.3 gene copies per µl of reaction. qPCR amplifications were carried out with the b-tubulin gene prim-ers (200 nM each) using Sybr Green Master Mix (Fermentas, Burlington, Canada) in a final vol-ume of 25 µl. Amplification cycling conditions were as follows: 10’ at 95°C; 1’ at 95°C, 1’ at 52°C, 30’’ at 72°C for 40 cycles. A final step for the melting curve analysis from 65°C to 95°C (increment of +0.5°C) was performed and the relative dissociation curve displayed a single specific dissociation peak at 74.50°C. The ob-tained standard curve showed high sensitivity, up to around 2.3 gene copies per µl of PCR re-action were detected.The qPCR protocol was then validated mixing W. anomalus cells with human blood samples. We tested the strain WaF17.12 and the four clinical isolates of W. anomalus. The yeasts were grown in YPD medium and incubated overnight at 28°C at 110 rpm to obtain an op-tical density 1.0 (3.2x107 cells/ml). Yeast cells were collected by centrifugation at 3500 rcf, 4°C for 10’ and diluted in sterile water. Eight serial dilutions from 3.2 x107 cells to 3.2 cells were obtained in a final volume of 200 µl of hu-man blood samples from a healthy donors (in triple replicates for each isolates). Total DNAs were extracted using the Jet Quick Blood DNA Spin Kit (Gentaur, Löhne, Germany) and sus-pended in 50 µl of sterile water. Fifty ng of the purified DNAs were used as templates for qPCR analysis at the same conditions described for the standard curve set-up. The relative dissoci-ation curves confirmed the same melting tem-perature as the standard curve, while no spe-cific peak was detected in the negative control reactions carried out with pure blood samples. The sequence analysis of the amplified product confirmed 100% homology with the GeneBank W. anomalus partial sequence of ß-tubulin gene available in GeneBank (JQ734945.1). The qPCR assay was able to detect up to around 16 yeast cells per ml of blood sample, for all the tested isolates (WaF17.12 and four W. anomalus clin-ical isolates).After the validation of the Wa-qPCR assay, we proceeded to screen the 525 selected blood samples. The DNA from these samples was obtained as described in Epis et al. (2012) and quantity and quality of the extracted samples were checked by spectrophotometer. Each sample was tested in triplicate (both undiluted and at a 1:10 dilution) and the positive control (DNA from WaF17.12 strain) was included. The template DNAs were subjected to the Wa-qPCR assay at the amplification conditions previously described. In addition, an amplification control was performed by running a parallel PCR test targeting the human Beta-2-microglobulin. Be-ta-2-microglobulin amplification was carried out using a new primer set, Bmicr2F (5’CTC-CGTGGCCTTAGCTGTG3’) and Bmicr2R (5’TTTGGAGTACGCTGGATAGCCT3’) (250 nM each) that amplifies a 69 bp fragment, follow-ing the conditions described for W. anomalus detection except for the annealing step (60°C for 30’’).The present study analysed a heterogeneous group, including healthy donors and different types of patients (critically ill adults and chil-dren, HIV and HCV patients, malaria patients), blood donors exposed to mosquito bites and healthy donors, in order to have an overview of the yeast circulation in humans exposed at different types of risk. The screening revealed an almost complete negativity of the analysed samples, with the exception of a single HCV patient that tested positive (3.9 copies of ß-tu-bulin gene per µl of reaction) at the Wa-qPCR S. Epis, A. Capone, E. Martin, M. Paolucci, C. Bazzocchi, M. Valzano, J. Bozic, S. Novati, G. Favia, I. Ricci580assay (Table 1). Sequence analysis of the am-plified product revealed the perfect match of the amplified fragment with the b-tubulin gene from W. anomalus (JQ734945.1). This newly obtained sequence was deposited in EMBL-EBI under the accession number LN680997. In ad-dition, to confirm the positivity of this sample and the negativity of 30 samples (a sub-sample, casually selected), we performed a nested-PCR targeted at 18S rRNA gene, for the specific W. anomalus detection following the protocol pub-lished in Ricci et al., 2011b. Application of this further method to the positive sample and to 30 samples that were negative at the first PCR confirmed our results.Our results support the view of W. anomalus as an organism considered safe for healthy indi-viduals and are coherent with the evidence of an uncommon opportunistic yeast (Taj-Aldeen et al., 2014). As stated in a recent review of the literature, W. anomalus infections have been re-ported occasionally and the occurrence of a few hundred positive cases (single cases and out-breaks) worldwide is estimated over a period longer than twenty years (Kalkanci et al., 2010).We found a single case out of 353 immunocom-promised patients (St. Orsola Malpighi, 243; Spedali Civili di Brescia, 10; S. Matteo Hospital, 100) and 164 healthy donors screened. Interest-ingly, no positivity was found in the malaria patients (exposed to malaria vector mosquito bites in Burkina Faso) and in the workers at the insectary (exposed to Anopheles and Aedes mosquitoes bite and to W. anomalus cultures). Nevertheless, the recognition of potentially pathogenic isolates is required for any future biotechnological applications of this yeast as a biocontrol agent. Our quantitative assay aimed at performing rapid mass screenings may effec-tively contribute to further investigations nec-essary for a better understanding of the epide-miology of W. anomalus infections.ACKNOWLEDGEMENTS The authors are grateful to Prof. Claudio Bandi (University of Milan), Prof. Luciano Polonelli (University of Parma), Dr Stefania Varani and Dr Paolo Gaibani (St. Orsola Malpighi Universi-ty Hospital), Dr Francesco Castelli (Spedali Civili di Brescia), Prof. Ayse Kalkanci (kindly provided W. anomalus strains, Gazi University Faculty of Medicine, Ankara,Turkey) and to all donors from the University of Camerino for providing blood or DNA samples to accomplish this research. The research was supported by Italian Ministry of Education, University and Research FIRB 2013 (RBFR136GFF, Dr Sara Epis) and by the Europe-an Union Seventh Framework Programme ERC 2011 (FP7/2007-2013_ FP7/2007-2011 under the grant agreement n.281222, Dr Irene Ricci).REFERENCESaragão P.a., oshiro i.c., MaNrique e.i., goMes c.c., Matsuo l.l., leoNe c., Moretti-braNchiNi M.l., leviN a.s. (2001). Pichia anomala outbreak in a nursery: exogenous source? Pediatr. Infect. Dis. J. 20, 843-848.caPPelli a., ulissi u., valzaNo M., DaMiaNi c., ePis s., gabrielli M.g., coNti s., PoloNelli l., baNDi c., Favia g., ricci i. (2014). A Wickerhamomy-ces anomalus killer strain in the malaria vector Anopheles stephensi. PLoS One. 9, e95988.De Hoog G.S. (1996). Risk assessment of fungi re-ported from humans and animals. Mycoses. 39, 407-417.ePis s., gaibaNi P., ulissi u., chouaia b., ricci i., Da-MiaNi c., saMbri v., castelli F., buelli F., DaFFoN-chio D., baNDi c., Favia g. (2012). Do mosquito-as-sociated bacteria of the genus Asaia circulate in humans? Eur. J. Clin. Microbiol. Infect. Dis. 31, 1137-1140.guyarD c., séguy N., cailliez J.c., Drobecq h., Polo-Nelli l., Dei-cas e., MerceNier a., MeNozzi F.D. (2002). Characterization of a Williopsissaturnus var. mrakii high molecular weight secreted killer toxin with broad-spectrum antimicrobial activity. J. Antimicrob. Chemother. 49, 961-971.hazeN K.c. (1995). New and emerging yeast patho-gens. Clin. Microbiol. Rev. 8, 462-478.huaNg c.h., chaNg M.t., huaNg l. (2012). Species identification of Wickerhamomyces anomalus and related taxa using b-tubulin (b-tub) DNA bar-code marker. Yeast. 29, 531-535.KaleNic s., JaNDrlic M., vegar v., zuech N., seKulic a., MliNaric-MissoNi e. (2001). Hansenula anomala outbreak at a surgical intensive care unit: a search for risk factors. Eur. J. Epidemiol. 17, 491-496.KalKaNci a., Dizbay M., turaN o., FiDaN i., yalçiN b., hirFaNog˘lu i., Kus˛tiMur s., aKtas˛ F., sugita t. (2010). Nosocomial transmission of Candida pelliculosa fungemia in a pediatric intensive care unit and review of the literature. Turk. J. Pediatr. 52, 42-49.KauKoNeN K.M., bailey M., Pilcher D., cooPer D.J., belloMo r. (2015). Systemic inflammatory re-A rapid qPCR method to investigate the circulation of the yeast Wickerhamomyces anomalus in humans 581sponse syndrome criteria in defining severe sep-sis. N. Engl. J. Med. 23, 1629-1638. oliveira v.K., ruiz lDa s., oliveira N.a., Moreira D., hahN r.c., Melo a.s., NishiKaKu a.s., Paula c.r. (2014). Fungemia caused by Candida species in a children’s public hospital in the city of São Paulo, Brazil: study in the period 2007-2010. Rev. Inst. Med. Trop. Sao Paulo. 56, 301-305.olstorPe M., Passoth v. (2011). Pichia anomala in grain biopreservation. Antonie Van Leeuwenhoek. 99, 57-62.Passoth v., olstorPe M., schNürer J. (2011). Past, present and future research directions with Pi-chia anomala. Antonie Van Leeuwenhoek. 99, 121-125.PoloNelli l., séguy N., coNti s., gerloNi M., berto-lotti D., caNtelli c., MagliaNi w., cailliez J.c. (1997). Monoclonal yeast killer toxin-like can-didacidal anti-idiotypic antibodies. Clin. Diagn. Lab. Immunol. 4, 142-146.ricci i., Mosca M., valzaNo M., DaMiaNi c., scuPPa P., rossi P., crotti e., caPPelli a., ulissi u., caPoNe a., esPosito F., alMa a., MaNDrioli M., sacchi l., baNDi c., DaFFoNchio D., Favia g. (2011a). Dif-ferent mosquito species host Wickerhamomyces anomalus (Pichia anomala): perspectives on vec-tor-borne diseases symbiotic control. Antonie Van Leeuwenhoek. 99, 43-50.ricci i., DaMiaNi c., scuPPa P., Mosca M., crotti e., rossi P., rizzi a., caPoNe a., goNella e., balla-riNi P., chouaia b., sagNoN N., esPosito F., alMa a., MaNDrioli M., sacchi l., baNDi c., DaFFoNchio D., Favia g. (2011b). The yeast Wickerhamomyces anomalus (Pichia anomala) inhabits the midgut and reproductive system of the Asian malaria vector Anopheles stephensi. Environ. Microbiol. 13, 911-921.swaNgKeaw J., vichitPhaN s., butzKe c.e., vichitPhaN K. (2009). The characteristics of a novel Pichia anomala b-glucosidase with potentially aro-ma-enhancing capabilities in wine. Ann. Micro-biol. 59, 335-343.taJ-alDeeN s.J., abDulwahab a., KolecKa a., DeshMuKh a., Meis J.F., boeKhout t. (2014). Uncommon op-portunistic yeast bloodstream infections from Qatar. Med. Mycol. 52, 552-556.thuler l.c., FaivicheNco s., velasco e., MartiNs c.a., NasciMeNto c.r., castilho i.a. (1997). Fungaemia caused by Hansenula anomala: an outbreak in a cancer hospital. Mycoses. 40, 193-196.toKi w., taNahashi M., togashi K., FuKatsu t. (2012). Fungal farming in a non-social beetle. PLoS One. 7, e41893.walKer g.M. (2011). Pichia anomala: cell physiology and biotechnology relative to other yeasts. An-tonie Van Leeuwenhoek. 99, 25-34.zuo r.y., chaNg J., yiN q.q., waNg P., yaNg y.r., waNg X., waNg g.q., zheNg q.h. (2013). Effect of the combined probiotics with aflatoxin B1-degrading enzyme on aflatoxin detoxification, broiler pro-duction performance and hepatic enzyme gene expression. Food. Chem. Toxicol. 59, 470-475.bianca

A rapid qPCR method to investigate the circulation of the yeast Wickerhamomyces anomalus in humans

https://pubblicazioni.unicam.it/bitstream/11581/390630/1/new%20micr..pdf

A rapid qPCR method to investigate the circulation of the yeast Wickerhamomyces anomalus in humans

Abstract

Similar works

Full text

Available Versions

Archivio istituzionale della ricerca - Università di Camerino