Please read abstract in the article.The Calgary Laboratory Services (#10015169)http://aac.asm.org2017-10-30hb2017Medical Microbiolog

Bradford, Patricia A.

Chen, Liang

Kazmierczak, Krystyna M.

Kreiswirth, Barry N.

Peirano, Gisele

Pitout, Johann D.D.

PubMed

UPSpace at the University of Pretoria

The importance of clonal complex 258 and IncFK2-like plasmids among a global collection of Klebsiella pneumoniae with blaKPCs Gisele Peirano1,2, Patricia A. Bradford3, Krystyna M. Kazmierczak4, Liang Chen5, Barry N. Kreiswirth5 and Johann D. D. Pitout1,2,6,7* Departments of Pathology & Laboratory Medicine, University of Calgary, Calgary, Alberta, Canada1; Division of Microbiology, Calgary Laboratory Services, Calgary, Alberta, Canada2; AstraZeneca Pharmaceuticals LP, Waltham, MA, USA3; International Health Management Associates, Schaumburg, Illinois, USA4; Public Health Research Institute TB Center, New Jersey Medical School, Rutgers University, Newark, NJ, USA5; Department of Microbiology, Immunology and Infectious Diseases, University of Calgary, Calgary, Alberta, Canada6; University of Pretoria, Pretoria, South Africa7 Keywords: Klebsiella pneumoniae, ST258, IncFK plasmids Running Title: K. pneumoniae ST258 with blaKPCs and IncFK2 plasmids *Corresponding Author: Johann D.D. PitoutCalgary Laboratory Services, #9, 3535 Research Road NW Calgary, Alberta, CANADA, T2L 2K8 Tel: +1 (403) 770 3309; Fax: +1(403) 770 3347 Email: johann.pitout@cls.ab.ca 1Abstract This study was designed to determine the global distribution of clonal complex (CC) 258 and IncFIIK2-like plasmids with blaKPC among 522 global KPC-producing K. pneumoniae. CC258 (i.e. ST258 [clades I and II], ST11, ST512) and ST147 were statistically associated with IncFIIK2-like KPC-containing plasmids and may possess an epidemiological advantage over isolates that harboured non-IncF KPC-harboring plasmids. 2The class A Klebsiella pneumoniae carbapenemases (KPC) ß-lactamases have been extensively reported in Klebsiella pneumoniae (1). KPC are present in more than 100 different K. pneumoniae sequence types (STs), but the KPC pandemic is primarily driven by the spread of members of clonal complex (CC) 258 namely sequence types (STs) 258 (clades I, II), ST11, ST340 and ST512 (1). Several different KPC-containing plasmids (i.e. IncF, IncI2, IncX, IncA/C, IncR, and ColE1) have been identified in CC258 (2), however, the most predominant plasmid type is IncF with FIIk replicons i.e. IncFIIK1 (FIBpKPN-like) and IncFIIK2 (FIBpKPQIL-like) (3). pKpQIL was the prototype of the IncFIIK2 group and one of the most common blaKPC-harboring plasmids, reported in Israel, USA, UK, Colombia and Italy (2). pKPN-3 was the prototype of the IncFIIK1 and was not initially associated with blaKPC but was as a virulence plasmid and co-resident with pKpQIL within ST258 (2). In the current study, we set out to determine the presence and global distribution of CC258 among a defined population consisting of 522 KPC-producing K. pneumoniae from the AstraZeneca’s (AZ) international surveillance study on antimicrobial resistance (2012–14). We also investigated the association of IncFIIK2-like plasmids containing blaKPC with CC258 strains in comparison to non-CC258 strains.  The AstraZeneca global surveillance program was initiated in 2012 and includes a wide representation of microbiology laboratories among the various continents (4). Up to 100 consecutive non-selected Gram-negative aerobic and facultative bacilli from each of participating countries/hospital were included. All organisms were deemed clinically significant based upon the criteria of the local investigators and were obtained from the urinary tract, skin structures, intra-abdominal, and lower respiratory tract specimens. The countries that participated in the surveillance include the following: Africa: Egypt, Kenya, Nigeria, South Africa. Asia: 3China, South Korea, Taiwan, Thailand. Europe: Austria, Belgium, Bulgaria, Greece, Czech Republic, Denmark, France, Germany, Hungary, Italy, Macedonia, Portugal, Poland, Russia, Romania, Slovakia, Spain, Turkey, United Kingdom. Latin America: Argentina, Brazil, Chile, Colombia, Mexico, Uruguay, Venezuela. Middle East: Lebanon, Israel, Syria, Kuwait. North America: United States. South Pacific: Australia, Philippines, Japan.   The AstraZeneca surveillance program does have some drawbacks; it only includes 100 consecutive non-selected Gram-negative aerobic and facultative bacilli from each of participating countries/hospital/year. It is therefore possible that the program will miss outbreaks of a particular resistance mechanism. The program is also biased towards sites that have AstraZeneca representation within that region/city/country (i.e. hospitals that can afford AstraZeneca products). Moreover, it only includes isolates from urinary tract, skin structures, intra-abdominal, and lower respiratory tract specimens. However, the program does have some significant advantages; it includes a wide representation of microbiology laboratories among the various continents, although Africa and Asia are underrepresented. It only includes clinically significant bacteria and is not biased towards a certain resistance phenotype. Therefore, it provides a “snapshot” view on what types of resistance determinants are endemic in the specific hospital/region. Molecular screening for blaKPC was performed on carbapenem resistant K. pneumoniae as described previously (5). Genetic relatedness between the isolates was initially determined using pulsed-field gel electrophoresis (PFGE) (6) and the major pulsotypes (i.e. those with more than 10 isolates pre pulsotype) also underwent multilocus sequencing typing (MLST) (7). PCR typing was used to determine the presence of blaKPCs on IncFIIK2-like types of plasmids and to also identify the different Tn4401 isotypes (8, 9). Table 1 illustrates the PCR primers and their 4Table 1. Primers and target sizes for the characterization of IncFIIK2-like plasmids that contain blaKPC PCR number Name Sequence Size (bp) Target ReferencePCR-I FIIK-repA-F1 CTTCACGTCCCGTTTTGATT 657 IncFII repA gene 3 FIIK-repA-R1 CGCTTCAGCGCTTCTTTATC PCR-II QIL-F1 ACAGGGAGTGCCAGGAAAG 2,001 Junction between Tn4401 tnpR and upstream IncFIIK2backbone gene 8 QIL-R1 TGTATTTGCATGGCGATGAG PCR-III Tn4401v-F(3098U) TGACCCTGAGCGGCGAAAGC 604 pKpQIL-associated Tn4401a isoform 9 Tn4401v-R1 GCAAGCCGCTCCCTCTCCAG Tn4401v-R(3781L) CACAGCGGCAGCAAGAAAGC PCR-IV QIL-F2 GCCTCAGATAGATGCGGTAGC 1,831 Junction between Tn4401 ISKpn6 and 9 5PCR number Name Sequence Size (bp) Target ReferenceQIL-R2 AAGCTGGAGACATGGAATGG downstream gene PCR-V QIL-hsdR-F1 GGGTCGTTCACAAAGTCGAT 498 IncFIIK2-associated type I restriction modification system hsdR gene 9 QIL-hsdR-R1 CGTTGAGCACTTCACCAAAA PCR-VI K2-repB-F1 CCATTCCGATCCTTTTCTGA 395 IncFIIK2 repFIB gene 9 K2-repB-R1 AACGCTACTGTCCAGCCTGT 6respective targets used in this study. IncFIIK2-like plasmids were identified with amplifications with all the primer sets namely I II, III, IV, V and VI.   PFGE identified four major pulsotypes (i.e. more than 10 isolates per pulsotype) among 412 (79%) of isolates, that were designated as follows; cluster A (n = 290), B (n=80), C (n=27), and D (n=15). We also recognized 3 minor pulsotypes (i.e. less than 10 isolates per pulsotype) among 23 (4%) of isolates, designated as follows; cluster E (n=9), F (n=7) and G (n=7). The remaining isolates (n=87 [17%]) were not clonally related, i.e. exhibited <60% similar PFGE profiles and did not show patterns similar to those from clusters A to G. MLST identified the different pulsotypes as follows: cluster A as ST258, B as ST11, C as ST147, D as ST512, E as ST189, F as ST15 and cluster G as ST437. ST258 was further differentiated into clades I and II (10).  The geographical distribution of the different blaKPCs, STs and IncFIIK2-like plasmids associated with blaKPC are shown in Table 2.    K. pneumoniae ST258 is a prototype of a high-risk clone and has been largely responsible for the global spread of carbapenem resistance among the Enterobactericeae (11). Kreiswirth and colleagues performed whole genome sequencing on a global collection of K. pneumoniae ST258 and showed that this ST belonged to two well defined lineages namely clade I and clade II: clade I was associated with KPC-2 and clade II was associated with KPC-3 (10). The majority of K. pneumoniae (n=290 [56%]) from our global collection belonged to ST258; clade I (n=165 [32%]) was associated with blaKPC-2 on IncFIIK2-like plasmids. This clade was mostly present in Argentina and Greece, and to a lesser extent in Belgium, China, Italy, Romania and USA (Table 2). ST258 clade II (n=125 [24%]) was associated with blaKPC-3 o n  I n c F I I K2-like plasmids. This clade was mainly identified in Italy and USA and to a lesser extent in Austria, Belgium, Brazil, Chile, Colombia, Germany, Greece, Israel, Mexico and Venezuela (Table 2). There was 7Table 2. Sequence types, global distribution, presence of IncFIIK2-like plasmids among Klebsiella pneumoniae with blaKPC Sequence Type Country of Isolation (no) KPC (no) IncFIIK2-like plasmids (no) ST258-I (n=165) Argentina (33), Belgium (2), China (1), Greece (104), Italy (11), Romania (4), USA (10)  KPC-2 (154), KPC-3 (9), KPC-9 (2)  103 ST258-II (n=125) Austria (1), Belgium (1), Brazil (7), Chile (1), Colombia (2), Germany (2), Greece (1), Israel (7), Italy (72), Mexico (1), USA (28), Venezuela (1) KPC-2 (22), KPC-3 (103)  85 ST11 (n=80) Argentina (7), Austria (1), China (19), Brazil (45), Colombia (1), Israel (1), Taiwan (1), USA 3), Venezuela (1)   KPC-2 (73), KPC-3 (6), KPC-12 (1)  33 ST147 (n=27) Argentina (2), Greece (20), Italy (1), Philippines (1), Romania (1), Venezuela (2)   KPC-2 (26), KPC-3 (1) 19 ST512 (n=15) Colombia (9), Israel (2), Italy (2), USA (2)  KPC-2 (4), KPC-3 (11)  5 ST189 (n=9) Colombia (8), Venezuela (1)  KPC-2 (9)  0 ST15 (n=7) Portugal (6), Colombia (1) KPC-2 (1), KPC-3 (6) 0 8ST437 (n=7) Brazil (7) KPC-2 (7)  0 Other STs (n=87) Argentina (12), Austria (1), Belgium (2), Brazil (4), China (1), Colombia (17), Czech Rep (1), Greece (5), Italy (10), Israel (5), Philippines (1), Portugal (13), Romania (1), UK (1), USA (9), Venezuela (4)    KPC-2 (56), KPC-3 (31) 19 9not a specific association of blaKPC-2 or blaKPC-3 with IncFIIK2-like plasmids (i.e. 40% of KPC-2 and 54% of KPC-3 were harboured on IncFIIK2-like plasmids (Table 2). ST11, which is closely related to ST258, is the major ST among K. pneumoniae harboring blaKPC from Asia (especially China) (12), Latin America (13) and sometimes contain other carbapenemases (14, 15). ST11 was the second most common ST in our study (n=80 [15%]), and was associated with blaKPC-2 on IncFIIK2-like plasmids. ST11 was present in Brazil and China and to a lesser extend in Argentina, Colombia, Israel, Taiwan, USA, and Venezuela (Table 2).  Other STs that belong to CC258 with blaKPC have been reported from Colombia (i.e. ST512), Italy (i.e. ST512), Israel (i.e. ST512), Brazil (i.e. ST340, ST437) and Greece (i.e. ST340) (13). The remaining members of CC258 from our study included ST512 and ST437. ST512, mainly from Colombia, was the fourth most common ST (n=15 [3%]) in our collection and was also identified in Israel, Italy and the USA (Table 2). The ST was associated with blaKPC-3 on IncFIIK2-like plasmids. ST437 (n=7) was identified in Brazil and did not contain IncF plasmids.  K. pneumoniae ST147 is an emerging high risk clone that was first identified in Greece and has been associated with blaVIM and blaKPC in that country (16). NDM (18) and OXA-181 (6) carbapenemases have also been described in ST147 from various countries, such as Switzerland, Iraq, Canada, UK, India and Italy (1). ST147, mainly from Greece, was the third most common ST (n=27 [5%]) in our study and was associated with blaKPC-2 on IncFIIK2-like plasmids. ST147 was also present in Argentina, Italy, Philippines, Romania and Venezuela (Table 2). 10The geographical distribution of the other minor STs was as follows: ST189 (n=9) in Colombia and ST15 (n=7) in Portugal (Table 2). The isolates that did not belong to major or minor STs (n=87) showed a global distribution. The IncFII (none k2-like) plasmids (n=141) contained the following Tn4401 isotypes: a (66[47%]), b (34[24%]) and d (5[4%]); IncFIIK2-like plasmids (n=264) only contained isotype a.   It has been postulated recently that the presence of IncF plasmids with FIIk replicons harboring blaKPC is central to the global success of CC258 and that they have significantly contributed to the evolutionary dominance of ST258 (11). Our molecular epidemiological data supports this hypothesis. The majority of CC258 from our study harboured IncFIIK2-like plasmids containing blaKPC when compared to non-CC258 STs (i.e. 226/392 [58%] vs 38/130 [23%] p<0.0001) {95% confidence interval 25.37 to 43.50}). This is especially true for ST258 in that 188/290 [65%] of plasmids with blaKPC from this ST belonged to IncFIIK2-like (Table 2). K. pneumoniae ST147 was also associated with IncF plasmids, especially IncFIIK2-like (Table 2). Our data suggests that certain successful high-risk K. pneumoniae clones (i.e. CC258 and ST147) are linked to specific narrow host range IncF plasmids with blaKPC, and this association may possess epidemiological advantages over other clones that carry non-IncF KPC plasmids. It is possible that the maintenance and co-evolution of GC258 with IncFK2-like plasmids have provided rapid and continual adaptation opportunities for this CC providing them with the additional ability to outcompete other K. pneumoniae clones. This scenario is consistent with both the macro- and micro-evolutionary versions of the Red Queen hypothesis of co-evolution (11). However, this might be a very simplistic view regarding the role of IncFK2-like plasmids in the success of CC258 and this CC frequently harbors non-F antimicrobial resistance plasmids (1). 11This study was not designed to specifically address the epidemiological advantage attributed to IncFIIK2-like plasmids as compared to other features of CC258. The IncFIIK2-like plasmids are clearly the most common KPC containing plasmids disseminating in K. pneumoniae but are not necessarily restricted to CC258 (i.e. 23% of non-CC258 STs also contained IncFIIK2-like plasmids).  To the best of our knowledge, this is the first study that provided a comprehensive overview on the global distribution of different STs with blaKPC, and their association with IncFIIK2-like plasmids in a defined population.  Funding This work was supported in part by a research grant from the Calgary Laboratory Services (#10015169). Transparency declaration JDDP had previously received research funds from Merck and Astra Zeneca. 12References 1. Pitout JD, Nordmann P, Poirel L. 2015. Carbapenemase-Producing Klebsiellapneumoniae, a Key Pathogen Set for Global Nosocomial Dominance. Antimicrob AgentsChemother 59:5873-5884.2. Chen L, Mathema B, Chavda KD, DeLeo FR, Bonomo RA, Kreiswirth BN. 2014.Carbapenemase-producing Klebsiella pneumoniae: molecular and genetic decoding.Trends Microbiol 22:686-696.3. Chen L, Chavda KD, Melano RG, Jacobs MR, Levi MH, Bonomo RA, KreiswirthBN. 2013. Complete sequence of a bla(KPC-2)-harboring IncFII(K1) plasmid from aKlebsiella pneumoniae sequence type 258 strain. Antimicrob Agents Chemother57:1542-1545.4. Kazmierczak KM, Rabine S, Hackel M, McLaughlin RE, Biedenbach DJ,Bouchillon SK, Sahm DF, Bradford PA. 2016. Multiyear, Multinational Survey of theIncidence and Global Distribution of Metallo-β-Lactamase-Producing Enterobacteriaceaeand Pseudomonas aeruginosa. Antimicrob Agents Chemother 60:1067-1078.5. Peirano G, Bradford PA, Kazmierczak KM, Badal RE, Hackel M, Hoban DJ, PitoutJD. 2014. Global incidence of carbapenemase-producing Escherichia coli ST131. EmergInfect Dis 20:1928-1931.13 6. Lascols C, Peirano G, Hackel M, Laupland KB, Pitout JD. 2013. Surveillance and  molecular epidemiology of Klebsiella pneumoniae isolates that produce carbapenemases:  first report of OXA-48-like enzymes in North America. Antimicrob Agents Chemother  57:130-136.  7. Diancourt L, Passet V, Verhoef J, Grimont PA, Brisse S. 2005. Multilocus sequence  typing of Klebsiella pneumoniae nosocomial isolates. J Clin Microbiol 43:4178-4182.  8. Chen L, Chavda KD, Melano RG, Hong T, Rojtman AD, Jacobs MR, Bonomo RA,  Kreiswirth BN. 2014. Molecular survey of the dissemination of two blaKPC-harboring  IncFIA plasmids in New Jersey and New York hospitals. Antimicrob Agents Chemother  58:2289-2294.  9. Chen L, Chavda KD, Melano RG, Jacobs MR, Koll B, Hong T, Rojtman AD, Levi  MH, Bonomo RA, Kreiswirth BN. 2014. Comparative genomic analysis of KPC- encoding pKpQIL-like plasmids and their distribution in New Jersey and New York  Hospitals. Antimicrob Agents Chemother 58:2871-2877.  10. Deleo FR, Chen L, Porcella SF, Martens CA, Kobayashi SD, Porter AR, Chavda  KD, Jacobs MR, Mathema B, Olsen RJ, Bonomo RA, Musser JM, Kreiswirth BN.  2014. Molecular dissection of the evolution of carbapenem-resistant multilocus sequence  type 258 Klebsiella pneumoniae. Proc Natl Acad Sci U S A 111:4988-4993.  14 11. Mathers AJ, Peirano G, Pitout JD. 2015. The role of epidemic resistance plasmids and  international high-risk clones in the spread of multidrug-resistant Enterobacteriaceae.  Clin Microbiol Rev 28:565-591.  12. Yang J, Ye L, Guo L, Zhao Q, Chen R, Luo Y, Chen Y, Tian S, Zhao J, Shen D,  Han L. 2013. A nosocomial outbreak of KPC-2-producing Klebsiella pneumoniae in a  Chinese hospital: dissemination of ST11 and emergence of ST37, ST392 and ST395. Clin  Microbiol Infect 19:E509-515.  13. Munoz-Price LS, Poirel L, Bonomo RA, Schwaber MJ, Daikos GL, Cormican M,  Cornaglia G, Garau J, Gniadkowski M, Hayden MK, Kumarasamy K, Livermore  DM, Maya JJ, Nordmann P, Patel JB, Paterson DL, Pitout J, Villegas MV, Wang H,  Woodford N, Quinn JP. 2013. Clinical epidemiology of the global expansion of  Klebsiella pneumoniae carbapenemases. Lancet Infect Dis 13:785-796.  14. Giske CG, Froding I, Hasan CM, Turlej-Rogacka A, Toleman M, Livermore D,  Woodford N, Walsh TR. 2012 Diverse sequence types of Klebsiella pneumoniae  contribute to the dissemination of blaNDM-1 in India, Sweden, and the United Kingdom.  Antimicrob Agents Chemother 56:2735-2738.  15. Williamson DA, Sidjabat HE, Freeman JT, Roberts SA, Silvey A, Woodhouse R,  Mowat E, Dyet K, Paterson DL, Blackmore T, Burns A, Heffernan H. 2012.  Identification and molecular characterisation of New Delhi metallo-β-lactamase-1  15(NDM-1)- and NDM-6-producing Enterobacteriaceae from New Zealand hospitals. Int J Antimicrob Agents 39:529-533. 16. Papagiannitsis CC, Kotsakis SD, Petinaki E, Vatopoulos AC, Tzelepi E, Miriagou V,Tzouvelekis LS. 2011. Characterization of metallo-beta-lactamase VIM-27, an A57Smutant of VIM-1 associated with Klebsiella pneumoniae ST147. Antimicrob AgentsChemother 55:3570-3572.17. Giakkoupi P, Papagiannitsis CC, Miriagou V, Pappa O, Polemis M, TryfinopoulouK, Tzouvelekis LS, Vatopoulos AC. 2011. An update of the evolving epidemic ofblaKPC-2-carrying Klebsiella pneumoniae in Greece (2009-10). J Antimicrob Chemother66:1510-1513.18. Peirano G, Pillai DR, Pitondo-Silva A, Richardson D, Pitout JD. 2011. Thecharacteristics of NDM-producing Klebsiella pneumoniae from Canada. Diagn MicrobiolInfect Dis 71:106-109.16

The importance of clonal complex 258 and IncFK2-like plasmids among a global collection of Klebsiella pneumoniae with blaKPCs

https://repository.up.ac.za/bitstream/2263/60260/1/Peirano_Importance_2017.pdf

The importance of clonal complex 258 and IncFK2-like plasmids among a global collection of Klebsiella pneumoniae with blaKPCs

Abstract

Similar works

Full text

Available Versions

UPSpace at the University of Pretoria