Deficiency of the 5-alpha-reductase may have an important role in 46,XY DSD in some cohorts. The prenatal ultrasonography and karyotyping can trigger the attention toward the presence of a DSD in fetus. Â© 2020 The Authors. Clinical Case Reports published by John Wiley & Sons Lt

Dalili, S.

Hassanzadeh Rad, A.

Koohmanaee, S.

Mahdieh, N.

Rabbani, B.

eprints Iran University of Medical Sciences

Clin Case Rep. 2020;00:1–5.    | 1wileyonlinelibrary.com/journal/ccr31 |  INTRODUCTIONSRD5A2 mutations have been reported to cause an autosomal recessive form of male pseudohermaphroditism (disorders of sex development: SDS). Here, a novel mutation in SRD5A2 gene is reported in an Iranian patient with pseudohermaphro-ditism. A 5-month-old infant with female genitalia referred to endocrinology clinic at Pediatric Center of Excellence. Existence of testes was confirmed by ultrasonography. Karyotype showed a 46,XY DSD. Molecular analysis in-cluding PCR and sequencing of SRD5A2 showed a novel variant in this gene. In silico analyses were also performed to determine the potential pathogenecity of this muta-tion. Sequencing of SRD5A2 gene showed a novel variant, c.476T  >  G (p.Ile159Arg). The variant was heterozygous in the patient's parents. Prediction analysis using available software tools such as PROVEAN and Phyre2 was consis-tent with pathogenicity of the variant. Considering that the Received: 14 June 2019 | Revised: 20 May 2020 | Accepted: 26 May 2020DOI: 10.1002/ccr3.3028  C A S E  R E P O R TA novel pathogenic variant of SRD5A2 in an Iranian psuedohermaphrodite maleSetilla Dalili1 |   Bahareh Rabbani2,3  |   Afagh Hassanzadeh Rad4 |   Shaahin Koohmanaee1 |   Nejat Mahdieh2,3,5This is an open access article under the terms of the Creative Commons Attribution-NonCommercial-NoDerivs License, which permits use and distribution in any medium, provided the original work is properly cited, the use is non-commercial and no modifications or adaptations are made.© 2020 The Authors. Clinical Case Reports published by John Wiley & Sons Ltd1Pediatric Endocrinologist, Pediatric Diseases Research Center, Guilan University of Medical Sciences, Rasht, Iran2Rajaie Cardiovascular Medical and Research Center, Iran University of Medical Sciences, Niayesh-Vali asr Intersection, Tehran, Iran3Growth and Development Research Center, Tehran University of Medical Sciences, Tehran, Iran4Phd of Linguistics, Pediatric Diseases Research Center, Guilan University of Medical Sciences, Rasht, Iran5Cardiogenetic Research Center, Rajaie Cardiovascular Medical and Research Center, Iran University of Medical Sciences, Niayesh-Vali asr Intersection, Tehran, IranCorrespondenceNejat Mahdieh and Bahareh Rabbani, Rajaie Cardiovascular Medical and Research Center, Iran University of Medical Sciences, Niayesh-Vali asr Intersection, Valiasr Street, Tehran, Iran.Emails: nmahdieh@gmail.com (N. M.); baharehrabbani@yahoo.com (B. R.)AbstractDeficiency of the 5-alpha-reductase may have an important role in 46,XY DSD in some cohorts. The prenatal ultrasonography and karyotyping can trigger the attention toward the presence of a DSD in fetus.K E Y W O R D Sdisorders of sex development, pseudohermaphroditism, SRD5A2, variant2 |   DALILI et AL.5-alpha-reductase deficiency unlike other diseases can be treated at pubertal age, early diagnosis could be helpful in treatment strategies in addition to prevention programs. In silico analysis is helpful to predict the pathogenicity of novel variants.Disorders of sex development (DSDs) are congenital anomalies, in which there is atypical development of sex-ual tissues.1,2 DSDs are categorized into several etiological groups; congenital adrenal hyperplasia (CAH), complete androgen insensitivity syndrome (CAIS), partial androgen insensitivity syndrome (PAIS), and 5-alpha-reductase defi-ciency (5ARD) are the most common causes of DSDs.3SRD5A2 mutations have been reported to cause an auto-somal recessive form of DSD. This gene, located on 2p23.1, encodes the 5-alpha-reductase which converts testosterone to dihydrotestosterone (DHT). DHT is required for development of normal male external genitalia.4 Patients with the SRD5A2 mutations may have variable clinical features from complete female genitalia, genital ambiguity to undervirilized male genitalia.5,6 Signs such as bifid scrotum, clitoral-like phallus, cryptorchidism, and pseudovaginal perineoscrotal hypospa-dias may be observed in patients.3,7More than one hundred SRD5A2 mutations have been reported at Human Gene Mutation Database (http://www.hgmd.cf.ac.uk/ac/index.php). Some mutations are frequent in specific populations, and ethnic-specific prevalence of mu-tations has been described.5 In this study, a novel variant in SRD5A2 gene is described in an Iranian patient. The pathoge-nicity of this variant is also confirmed.2 |  METHODS2.1 | Case presentation and workupA 5-month-old infant with female genitalia was referred to the endocrinology clinic (Figure  1A). Prenatal screening (amniocentesis) had showed a 46,XY karyotype. However, repeated ultrasonogrphic findings reported female genitalia. The initial karyotype 46,XY and the prenatal ultrasonogra-phy which showed female external genitalia triggered the at-tention toward the probable presence of a DSD in this child. At 5th month after birth, an ultrasound was performed and reported no testicles, but second ultrasound confirmed the existence of both testicles in the inguinal canals.There were no report of ovaries or uterus in the ultra-sounds, and there was a pseudovagina. Regarding the lack of electrolyte imbalance and definite female genitalia during first 5 months, it was unlikely that the patient had congenital ad-renal hyperplasia. Therefore, 46,XY DSD was noted for this F I G U R E  1  Pedigree of the family (A) and electropherograms (B) of normal, the patient and his parents; c.476T > G substitution causes Ile to Arg at position 159 of protein. The parents are heterozygotes for this variant, and the patient is homozygoteT A B L E  1  The result of biochemical testTest ResultNormal rangeUnitMale FemaleLH 1.02 1-9 2-10 IU/LFSH 0.25 1-10 20-50 IU/L17OHP 66.2 20-100 20-100 ng/dLTestosterone/DHT 25 275-875 23-75 ng/dLFree testosterone 0.0 0.4-0.9 0.15-0.6 pg/mLNa (Sodium) 130 135-145 135-145 mEq/LK (Potassium) 3.5 3.7-5.9 3.7-5.9 mEq/LAbbreviations: 17OHP, 17-hydroxyprogesterone; DHT, dihydrotestosterone; FSH, follicle-stimulating hormone; LH, Luteinizing hormone.T A B L E  2  Primer sequences for coding regions of SRD5A2 in this studyExon no. Primer sequences 5′ to 3′ direction1 ForwardReverseAGAAAGGGGTATTGCTGCGACTTGTCAACTCTCTAGCGTCCAA2 ForwardReverseCTTAAGAAAGAGGTGGGGATGAGAATTGCAGTAGGGAGAGGCCAT3 ForwardReverseGCCACGTCTTAGGACCATTCTTAGTATCATTCGTGCCCTCACTGT4 ForwardReverseGATTCCACCAAACTCCTATGACTCTTCGGTTTCTCAATCTTCCTC5 ForwardReverseCATCGAAATAGTCAGGCCCAACAATAGCTAAGAAGCAACTGTCGC   | 3DALILI et AL.patient. Human chorionic gonadotropin test with three dos-ages was performed to assess the function of testosterone and its receptor and to furthermore rule out the androgen insen-sitivity syndrome and deficiency in 5-alpha-reductase. The results of biochemical tests for the patient showed normal go-nadotropins, normal electrolytes, slightly increased testoster-one, and increased testosterone/dihydrotestosterone ratio (25) (summarized in Table 1). Then, 5-alpha-reductase deficiency was suspected, for which molecular genetic testing was per-formed; a pathogenic homozygous mutation in SRD5A2 gene was detected in the patient. Both parents were heterozygote for this mutation (Figure 1B).2.2 | Genetic testingAn informed consent form was signed by the patient's par-ents; 5 mL of peripheral whole blood was taken from the pa-tient. Genomic DNA was extracted using standard salting out protocol. Quantity of DNA was assessed using a spectropho-tometer (NanoDrop ND2000c; Thermo Scientific).The coding regions and exon-intron boundaries of SRD5A2 (NG_008365.1; NM_000348.3) were amplified using the forward and reverse primers (Table 2). Briefly, PCR was per-formed in a final volume of 50 µL reagents; forward and re-verse primers (10 pmol), template DNA (150 ng), Taq DNA polymerase (0.2 units/µL), MgCl2 (1.5 mmol/L), and dNTPs (0.4 mmol/L for each nucleotide) were used to amplify the regions by the following PCR program: initial denaturation 5  minutes at 94°C and 30 cycles for denaturation at 94°C (30  seconds), annealing at 62°C (30  seconds), extension at 72°C (30 seconds), and final extension at 72°C (7 minutes). The PCR products were directly sequenced using a sequenc-ing analyzer ABI PRISM™ 3500 (PE Applied Biosystems) by a BigDye termination method.Available online software tools including sorting intolerant from tolerant (SIFT), PROVEAN, combined annotation-de-pendent depletion (CADD), and polymorphism phenotyping (PolyPhen-2 v2.1) were applied to predict pathogenic scores of the variant.A multiple amino acid sequence alignment was done using UniProt protein family members (UniProtKB/F I G U R E  2  A, Amino acid alignment of SRD5A2 protein among different orthologous and paralogous members adapted from UniProt protein family members. p.Ile159 (indicated in the box) is a highly conserved residue in this protein among different species. B, Phyre 2 prediction for effect of p.Ile159Arg on secondary structure of SRD5A2 protein4 |   DALILI et AL.Swiss-Prot P31213) to check conservation of the mutated residue (Figure  2). Protein homology/analogy recognition engine V2.0 (Phyre2) and iterative threading assembly re-finement (I-TASSER) server were used to predict the effects of variant on the function and structure of protein.3 |  RESULTSOne benign homozygous variant, c.265C > G (p.Leu89Val), was found in the patient as well as a novel variant of unknown significance (VUS), c.476T > G (p.Ile159Arg). Testing both parents for this mutation also showed that parents are hete-rozygote for this mutation. According to ClinVar, c.265C > G is a benign variant with a high frequency in normal popula-tion; thus, we did not check the benign variant in the parents. In silico analyses predicted the pathogenicity of this variant using PROVEAN (score of −6.715). Alignment analysis showed that p.Ile159 is a conserved amino acid (Figure 2). Phyre2 predicted p.Ile159Arg affects the secondary structure of the protein.4 |  DISCUSSIONThe SRD5A2 gene encoding steroid 5-alpha-reductase 2 is responsible for converting testosterone to dihydrotestoster-one (DHT) using a double-bounded reduction. Recent studies have shown this enzyme is localized in endoplasmic reticulum (ER).8 Schematics of the SRD5A2 protein is shown in Figure 3. Normal plasma level of DHT is required for masculinization in male. Regarding female genitalia with male karyotype and clear increased testosterone/dihydrotestosterone ratio (25) after the HCG test, we aimed to check 5-alpha-reductase deficiency and genetic testing was performed for this patient.A novel variant, c.476T > G (p.Ile159Arg), was found in our patient. Testing family members for this mutation showed only the patient is homozygote for the variant, and both par-ents are heterozygotes. This variant has not been reported in databases such as ExAc, 1000genomes, and Iranome as well as HGMD and disease-specific databases. Online software tools also predicted that it may act as a pathogenic variant. On the other hand, alignment analysis using UniProt showed p.Ile159 is conserved among other species (Figure 2); that is, it may have F I G U R E  3  Schematic possible structure of microsomal 5-alpha-reductase domains based on (A) UniProt database annotation and (B) Phyre 2 prediction. p.Ile159Arg is located in a transmembrane domain   | 5DALILI et AL.an important role in this protein. p.Ile159 is located in a trans-membrane domain; when it is substituted by arginine, the sec-ondary structure of this domain may be affected. Our previous studies have shown that Iranian subpopulations have specific mutations with different frequencies in various disorders.9–11Avendaño et al5 reviewed 256 patients with 46XY DSD; cli-toromegaly and hypospadias were found in 66% and 40% of pa-tients, respectively, while our patient did not show microphalus or hypospadias. Furthermore, in the current study, there were no significant abnormal urogenital characteristics. In addition, cryptorchidism was reported in about 20% of these patients but in the current study, the existence of testes in inguinal region bilaterally was confirmed. Interestingly, as found in our patient, all cases in Avendaño's study showed virilization at puberty.As we know patients with 5-alpha-reductase deficiency un-like other diseases can be repaired at pubertal age, thus, it is recommended to pay special attention to this disease and to de-termine gene mutation of patients at early stages. In silico anal-ysis is helpful to predict the pathogenicity of novel variants.ACKNOWLEDGMENTSWe thank Dr Han Brunner for critical reading of the manuscript. We also thank all staff of Cardiogenetic Research Laboratory, Rajaie Cardiovascular Center for their assistance.CONFLICT OF INTERESTNone declared.AUTHOR CONTRIBUTIONSSD, AH, SHK, NM, and BR: performed the diagnostic steps for workup of patient along with his clinical data collection; NM: drafted the manuscript; all the authors: have accepted responsibility for the entire content of this submitted manu-script and approved submission.ORCIDBahareh Rabbani   https://orcid.org/0000-0003-1083-1660 Nejat Mahdieh   https://orcid.org/0000-0002-8614-1538 REFERENCES 1. Ostrer H. Disorders of sex development (DSDs): an update. J Clin Endocrinol Metab. 2014;99:1503-1509. 2. Sandberg DE, Callens N, Wisniewski AB. Disorders of Sex Development (DSD): networking and standardization consider-ations. Horm Metab Res. 2015;47:387-393. 3. Witchel SF. Disorders of sex development. Best Pract Res Clin Obstet Gynaecol. 2018;48:90-102. 4. Imperato-McGinley J, Zhu YS. Androgens and male physiology the syndrome of 5alpha-reductase-2 deficiency. Mol Cell Endocrinol. 2002;198:51-59. 5. Avendano A, Paradisi I, Cammarata-Scalisi F, Callea M. 5-al-pha-Reductase type 2 deficiency: is there a genotype-phenotype correlation? A review. Hormones (Athens). 2018;17:197-204. 6. Imperato-McGinley J, Guerrero L, Gautier T, Peterson RE. Steroid 5alpha-reductase deficiency in man: an inherited form of male pseudohermaphroditism. Science. 1974;186:1213-1215. 7. Houk CP, Lee PA. Consensus statement on terminology and man-agement: disorders of sex development. Sex Dev. 2008;2:172-180. 8. Scaglione A, Montemiglio LC, Parisi G, et al. Subcellular local-ization of the five members of the human steroid 5alpha-reductase family. Biochim Open. 2017;4:99-106. 9. Mahdieh N, Bagherian H, Shirkavand A, Sharafi M, Zeinali S. High level of intrafamilial phenotypic variability of non-syndromic hearing loss in a Lur family due to delE120 mutation in GJB2 gene. Int J Pediatr Otorhinolaryngol. 2010;74:1089-1091. 10. Ramazani A, Kahrizi K, Razaghiazar M, Mahdieh N, Koppens P. The frequency of eight common point mutations in CYP21 gene in Iranian patients with congenital adrenal hyperplasia. Iran Biomed J. 2008;12:49-53. 11. Riazalhosseine Y, Nishimura C, Kahrizi K, et al. Delta (GJB6-D13S1830) is not a common cause of nonsyndromic hearing loss in the Iranian population. AIM. 2005;8:104-108.How to cite this article: Dalili S, Rabbani B, Hassanzadeh Rad A, Koohmanaee S, Mahdieh N. A novel pathogenic variant of SRD5A2 in an Iranian psuedohermaphrodite male. Clin Case Rep. 2020;00:1–5. https://doi.org/10.1002/ccr3.3028

A novel pathogenic variant of SRD5A2 in an Iranian psuedohermaphrodite male

http://eprints.iums.ac.ir/33891/1/A%20novel%20pathogenic%20variant%20of%20SRD5A2%20in%20an%20Iranian%20psuedohermaphrodite%20male.pdf

A novel pathogenic variant of SRD5A2 in an Iranian psuedohermaphrodite male

Abstract

Similar works

Full text

Available Versions

eprints Iran University of Medical Sciences