2020 The Authors Dermal fibroblasts were donated by a 43 year old male patient with clinically diagnosed familial amyotrophic lateral sclerosis (ALS), carrying the SOD1E101G mutation. The induced pluripotent stem cell (iPSC) line UOWi007-A was generated using repeated mRNA transfections for pluripotency transcription factors Oct4, Klf4, Sox2, c-Myc, Lin28 and Nanog. The iPSCs carried the SOD1E101G genotype and had a normal karyotype, expressed expected pluripotency markers and were capable of in vitro differentiation into endodermal, mesodermal and ectodermal lineages. This iPSC line may be useful for investigating familial ALS resulting from a SOD1 E101G mutation

Balez, Rachelle

Bax, Monique

Berg, Tracey

Blair, Ian

Do-Ha, Phuong Dzung

E Castro Cabral Da Silva, Mauricio

Engel, Martin

Ooi, Lezanne

Rowe, Dominic

Sanz Munoz, Sonia

Stevens, Claire H

Yang, Shu

English

Research Online

University of Wollongong Research Online Faculty of Science, Medicine and Health - Papers: Part B Faculty of Science, Medicine and Health 1-1-2020 The mRNA-based reprogramming of fibroblasts from a SOD1E101G familial amyotrophic lateral sclerosis patient to induced pluripotent stem cell line UOWi007 Rachelle Balez University of Wollongong, rb478@uowmail.edu.au Tracey Berg University of Wollongong, tberg@uow.edu.au Monique Bax University of Wollongong, mcb675@uowmail.edu.au Sonia Sanz Munoz University of Wollongong, University of Wollongong, ssm886@uowmail.edu.au Mauricio E Castro Cabral Da Silva University of Wollongong, mcastro@uow.edu.au See next page for additional authors Follow this and additional works at: https://ro.uow.edu.au/smhpapers1 Publication Details Citation Balez, R., Berg, T., Bax, M., Sanz Munoz, S., E Castro Cabral Da Silva, M., Engel, M., Do-Ha, P., Stevens, C. H., Rowe, D., Yang, S., Blair, I., & Ooi, L. (2020). The mRNA-based reprogramming of fibroblasts from a SOD1E101G familial amyotrophic lateral sclerosis patient to induced pluripotent stem cell line UOWi007. Faculty of Science, Medicine and Health - Papers: Part B. Retrieved from https://ro.uow.edu.au/smhpapers1/1140 Research Online is the open access institutional repository for the University of Wollongong. For further information contact the UOW Library: research-pubs@uow.edu.au The mRNA-based reprogramming of fibroblasts from a SOD1E101G familial amyotrophic lateral sclerosis patient to induced pluripotent stem cell line UOWi007 Abstract 2020 The Authors Dermal fibroblasts were donated by a 43 year old male patient with clinically diagnosed familial amyotrophic lateral sclerosis (ALS), carrying the SOD1E101G mutation. The induced pluripotent stem cell (iPSC) line UOWi007-A was generated using repeated mRNA transfections for pluripotency transcription factors Oct4, Klf4, Sox2, c-Myc, Lin28 and Nanog. The iPSCs carried the SOD1E101G genotype and had a normal karyotype, expressed expected pluripotency markers and were capable of in vitro differentiation into endodermal, mesodermal and ectodermal lineages. This iPSC line may be useful for investigating familial ALS resulting from a SOD1 E101G mutation. Publication Details Balez, R., Berg, T., Bax, M., Sanz Munoz, S., E Castro Cabral Da Silva, M., Engel, M., Do-Ha, P., Stevens, C., Rowe, D., Yang, S., Blair, I. & Ooi, L. (2020). The mRNA-based reprogramming of fibroblasts from a SOD1E101G familial amyotrophic lateral sclerosis patient to induced pluripotent stem cell line UOWi007. Stem Cell Research, 42 Authors Rachelle Balez, Tracey Berg, Monique Bax, Sonia Sanz Munoz, Mauricio E Castro Cabral Da Silva, Martin Engel, Phuong Dzung Do-Ha, Claire H. Stevens, Dominic Rowe, Shu Yang, Ian Blair, and Lezanne Ooi This journal article is available at Research Online: https://ro.uow.edu.au/smhpapers1/1140 Contents lists available at ScienceDirectStem Cell Researchjournal homepage: www.elsevier.com/locate/scrLab resource: Stem Cell LineThe mRNA-based reprogramming of fibroblasts from a SOD1E101G familialamyotrophic lateral sclerosis patient to induced pluripotent stem cell lineUOWi007Rachelle Baleza,b, Tracey Berga,b, Monique Baxa,b, Sonia Sanz Muñoza,b,Mauricio C. Cabral-da-Silvaa,b, Martin Engela,b, Dzung Do-Haa,b, Claire H. Stevensa,b,Dominic Rowec, Shu Yangc, Ian P. Blairc, Lezanne Ooia,b,⁎a Illawarra Health and Medical Research Institute, Wollongong, NSW 2522, Australiab School of Chemistry and Molecular Bioscience, University of Wollongong, Wollongong, NSW 2522, Australiac Centre for Motor Neuron Disease Research, Department of Biomedical Sciences, Faculty of Medicine and Health Sciences, Macquarie University, Sydney, NSW, AustraliaA B S T R A C TDermal fibroblasts were donated by a 43 year old male patient with clinically diagnosed familial amyotrophic lateral sclerosis (ALS), carrying the SOD1E101Gmutation. The induced pluripotent stem cell (iPSC) line UOWi007-A was generated using repeated mRNA transfections for pluripotency transcription factors Oct4,Klf4, Sox2, c-Myc, Lin28 and Nanog. The iPSCs carried the SOD1E101G genotype and had a normal karyotype, expressed expected pluripotency markers and werecapable of in vitro differentiation into endodermal, mesodermal and ectodermal lineages. This iPSC line may be useful for investigating familial ALS resulting from aSOD1 E101G mutation.Resource tableUnique stem cell line i-dentifierUOWi007-AAlternative name(s) ofstem cell lineMQ54-2Institution Illawarra Health and Medical Research Institute,University of WollongongContact information ofdistributorLezanne Ooi, lezanne@uow.edu.auType of cell line iPSCOrigin HumanAdditional origin info Age: 43Sex: MaleCell Source Dermal fibroblastClonality ClonalMethod of reprogram-mingTransgene free, mRNA based reprogramming with Oct4,Klf4, Sox2, c-Myc, Lin28 and Nanog.Genetic Modification YesType of Modification HereditaryAssociated disease Amyotrophic lateral sclerosisGene/locus SOD1E101GMethod of modification N/AName of transgene or r-esistanceN/AInducible/constitutive s-ystemN/ADate archived/stock da-te12.04.2018Cell line repository/ba-nkN/AEthical approval HE13/272 University of Wollongong Human ResearchEthics Committee1. Resource utilityThis iPSC line can be used to investigate familial ALS resulting froma SOD1E101G mutation. This resource is available under request owingto the Materials Transfer Agreement in place.2. Resource detailsDermal fibroblasts were obtained from a 43 year old male patient byMacquarie University, Australia. The patient was clinically diagnosedwith familial amyotrophic lateral sclerosis (ALS), heterozygous for theSOD1E101G mutation (also termed SOD1E100G due to N-terminal me-thionine cleavage). The SOD1 gene encodes the cytosolic antioxidantenzyme, copper-zinc superoxide dismutase (SOD1). Mutant SOD1E101Gretains the wild-type-like dismutase activity of the enzyme with pa-thology hypothesized to be due to misfolding and subsequent ag-gregation of mutant SOD1 (Valentine et al., 2005; Farrawell et al.,https://doi.org/10.1016/j.scr.2020.101701Received 30 August 2019; Received in revised form 20 December 2019; Accepted 5 January 2020⁎ Corresponding author: Dr Lezanne Ooi, Illawarra Health and Medical Research Institute, Wollongong, NSW 2522, Australia.E-mail address: lezanne@uow.edu.au (L. Ooi).Stem Cell Research 42 (2020) 101701Available online 16 January 20201873-5061/ © 2020 The Authors. Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/).T2019).Reprogramming was performed using repeated mRNA transfectionsfor pluripotency transcription factors Oct4, Klf4, Sox2, c-Myc, Lin28and Nanog. The first iPSC colonies appeared on day 14 and were iso-lated on day 17 for expansion and characterisation, with clone 2(UOWi007-A) selected following confirmation of pluripotency. TheUOWi007-A line was authenticated against its parental fibroblast linevia short tandem repeat (STR) profiling, with sequencing confirmingthe presence of the SOD1E101G mutation (Fig. 1A). The UOWi007-Acolonies had a normal karyotype (Fig. 1B), with no abnormalities de-tected in 15 cells at 400 bands per haploid set and had characteristicstem cell morphology (Fig. 1C). Immunocytochemical analysis con-firmed expression of pluripotency markers Oct4, SSEA-4 and TRA-1-60(Fig. 1D). Transcription of endogenous pluripotency genes NANOG andPOU5F1 (Oct4) by quantitative RT-PCR (RT-qPCR) showed a 360 and2700 fold increase, respectively, in UOWi007-A in comparison toFig. 1. Characterization of iPSC line UOWi007-A.R. Balez, et al. Stem Cell Research 42 (2020) 1017012parental fibroblasts (Fig. 1E) and similar expression levels compared toanother iPSC line UOWi002-A (Muñoz et al., 2018). In addition, plur-ipotency was assessed using the hPSC Scorecard assay, with an upre-gulation of mesodermal, endodermal and ectodermal specific genes anda downregulation of genes associated with pluripotency (Fig. 1F).3. Materials and methods3.1. Reprogramming of human dermal fibroblastsDermal fibroblasts were cultured in Dulbecco's Modified EagleMedium F12 (DMEM/F12, Thermo Fisher Scientific) with 1x Non-Essential Amino Acids (Thermo Fisher Scientific) and 10% foetal bovineserum (Interpath) at 37 °C and 5% CO2. Fibroblasts were reprogrammedusing StemMACS mRNA Reprogramming Kit (Myltenyi Biotec #130-104-460) following the manufacture's protocol. Spontaneous iPSC co-lonies were isolated and expanded into individual iPSC lines (clones).Established iPSC clones were maintained in TeSR-E8™ (StemcellTechnologies) on Matrigel-coated plates (Corning) at 37 °C and 5% CO2and passaged (1:5) using dispase (Stemcell Technologies) (See Table 1).The study was approved by the University of Wollongong Human EthicsCommittee (HE 13/272).3.2. SequencingGenomic DNA was extracted using the ISOLATE II Genomic DNA Kit(Bioline), with DNA amplified by PCR using MyTaq HS DNAPolymerase (Bioline) with the SOD1 primers (Table 2). Sequencing re-actions were performed using the ABI BigDye Terminator v3.1 ReadyReaction Mix and separated using the 3500xL Genetic Analyzer(Applied Biosystems). BioEdit (Ibis Therapeutics) was used to analysethe sequences.3.3. KaryotypingKaryotyping was performed at Sullivan Nicolaides Pathology PtyLtd (Brisbane, Australia), on iPSCs at passage 24, with 15 metaphasespreads counted at 400 bphs.3.4. Immunofluorescence stainingThe iPSCs were fixed in 4% paraformaldehyde for 10 min, per-meabilised with 0.05% Triton-X for 7 min (SSEA-4) or 15 min (Oct4)and blocked in 10% goat serum for 1 h at 22 °C. Primary antibodiesOct4 and SSEA-4 (Table 2) were incubated overnight at 4 °C, followedby secondary antibody (Table 2) for 1 h at 22 °C. Cultures were counterstained with Reddot2 (1:200, Biotium) for 10 min at 22 °C. For TRA-1-60 staining, cultures were incubated with TRA-1-60 live stain followingmanufacture's protocol. Immunocytochemical preparations were im-aged with a Leica DMI6000B confocal microscope and acquired usingLAS AF 2.6 software (Leica Microsystems).3.5. Quantitative polymerase chain reaction (qPCR)Fibroblast and iPSC RNA was extracted using Tri-Reagent (MRCGene) as per manufacture's protocol. Genomic DNA was removed usingthe Turbo DNAse kit (Thermo Fisher Scientific) and RNA purity de-termined using a Nanodrop 2000C. Tetro Reverse Transcriptase kit wasused for cDNA synthesis (Bioline). The expression of POU5F1 andNANOG was assessed via qPCR using SensiFast SYBR (Bioline) on theTable 1Characterization and validation.Classification Test Result DataMorphology Photography Normal Fig. 1CPhenotype Immunocytochemistry Expression of pluripotency markers Oct4, SSEA-4, TRA-1-60Fig. 1DRT-qPCR Cells express POU5F1, NANOG Fig. 1EGenotype Karyotype (G-banding) and resolution 46XY, resolution: 400 bphs Fig. 1BIdentity Microsatellite PCR (mPCR) OR N/A N/ASTR analysis 18 sites tested, matched Submitted in archive with journalMutation analysis (IF APPLICABLE) Sequencing Yes - SOD1E101G mutation Fig. 1ASouthern Blot OR WGS N/A N/AMicrobiology and virology Mycoplasma Luminescence, negative Supplementary file 1Differentiation potential TaqMan hPSC scorecard Passed Fig. 1FDonor screening (OPTIONAL) HIV 1 + 2 Hepatitis B, Hepatitis C N/A N/AGenotype additional info (OPTIONAL) Blood group genotyping N/A N/AHLA tissue typing N/A N/ATable 2Reagents details.Antibodies used for immunocytochemistry/flow-cytometryAntibody Dilution Company Cat # and RRIDPluripotency markers Oct4 1:000 Stemcell Technologies Cat# 01550, RRID: AB_1118539SSEA-4 1:200 Abcam Cat# 16286, RRID: AB_778073TRA-1-60 1:200 Stemcell Technologies Cat# 60064A, RRID: AB_2686905Secondary antibodies Alexa Fluor 488 Goat Anti-Mouse IgG (H+L) 1:1000 Thermo Fisher Scientific Cat# A11001, RRID: AB_2534069PrimersTarget Forward/reverse primer (5′−3′)Sequencing SOD1 CATCAGCCCTAATCCATCTGA/ CGCGACTAACAATCAAAGTGAPluripotency Genes (qPCR) POU5F1 GATCACCCTGGGATATACAC/ GCTTTGCATATCTCCTGAAGNANOG CCAGAACCAGAGAATGAAATC/ TGGTGGTAGGAAGAGTAAAGHouse-Keeping Genes (qPCR) GAPDH GAGCACAAGAGGAAGAGAGAGACCC/ GTTGAGCACAGGGTACTTTATTGATGGTACATGHPRT1 TGACACTGGCAAAACAATGCA/ GGTCCTTTTCACCAGCAAGCTRRID requirement for antibodies: use http://antibodyregistry.org/ to retrieve RRID for antibodies and include ID in table as shown in examples.R. Balez, et al. Stem Cell Research 42 (2020) 1017013Corbett RotorGene 3000 (Thermo Fisher Scientific) and normalised tothe expression of housekeeper genes HPRT1 and GAPDH. Difference inexpression was calculated via the ΔΔct method.3.6. ScorecardMesodermal and endodermal differentiation was induced using theSTEMdiff Mesoderm Induction Medium (Stemcell Technologies) andSTEMdiff Definitive Endoderm Kit (Stemcell Technologies), respec-tively, following the manufacture's protocols. Induction of ectodermaldifferentiation was achieved using Neural Induction medium (DMEM/F12, 1% N2, 0.4% B27, 1% MEM Non-essential amino acids, 1%GlutaMAX) supplemented with 1 μM LDN193189 (Focus Bioscience) for2 days. The iPSC colonies were detached with dispase (Thermo FisherScientific) to form embryoid bodies and cultured in Neural Inductionmedium supplemented with 3 μM CHIR99021 (Focus Bioscience) and2 μM SB431542 (Focus Bioscience) for 7 days. From each culture, cDNAwas mixed at a ratio of 1:1:1, with 1 μg analysed with the TaqMan hPSCScorecard (Thermo Fisher Scientific) following the manufacturer'sprotocol.3.7. STR analysisSTR analysis of 18 locations was performed at Garvan MolecularGenetics Institute (Darlinghurst, Australia).Declaration of Competing InterestNone.AcknowledgementsThis work was supported by research grants from the MotorNeurone Disease Research Institute of Australia (Grant-in-Aid awardedto LO), and the National Health and Medical Research Council ofAustralia (NHMRC, APP1095215). LO is supported by an NHMRCBoosting Dementia Research Leadership Fellowship (APP1135720). RBis supported by the Australian Government Research Training ProgramAward (AGRTP). The authors wish to acknowledge the fibroblast donorthat made this research possible.Supplementary materialsSupplementary material associated with this article can be found, inthe online version, at doi:10.1016/j.scr.2020.101701.ReferencesFarrawell, N.E., Yerbury, M.R., Plotkin, S.S., McAlary, L., Yerbury, J.J., 2019. CuATSMprotects against the in vitro cytotoxicity of wild-type-like copper–zinc ouperoxidedismutase mutants but not mutants that disrupt metal binding. ACS Chem. Neurosci.10 (3), 1555–1564.Muñoz, S.S., Balez, R., Cabral-da-Silva, M.e.C., Berg, T., Engel, M., Bax, M., Do-Ha, D.,Stevens, C.H., Greenough, M., Bush, A., Ooi, L., 2018. Generation and characteriza-tion of human induced pluripotent stem cell lines from a familial Alzheimer's diseasePSEN1 A246E patient and a nondemented family member bearing wild-type PSEN1.Stem Cell Res 31, 227–230.Valentine, J.S., Doucette, P.A., Potter, S.Z., 2005. Copper-zinc superoxide dismutase andamyotrophic lateral sclerosis. Annu. Rev. Biochem. 74, 563–593.R. Balez, et al. Stem Cell Research 42 (2020) 1017014

The mRNA-based reprogramming of fibroblasts from a SOD1\u3csup\u3eE101G\u3c/sup\u3e familial amyotrophic lateral sclerosis patient to induced pluripotent stem cell line UOWi007

https://ro.uow.edu.au/cgi/viewcontent.cgi?article=2154&amp;context=smhpapers1

The mRNA-based reprogramming of fibroblasts from a SOD1\u3csup\u3eE101G\u3c/sup\u3e familial amyotrophic lateral sclerosis patient to induced pluripotent stem cell line UOWi007

Abstract

Similar works

Full text

Available Versions

Research Online