We have generated two human induced pluripotent stem cell (iPSC) lines from CD133+ cells isolated from umbilical cord blood (CB) of a female child using non-integrative Sendai virus. Here we describe the complete characterization of these iPSC lines: PRYDi-CB5 and PRYDi-CB40

Arellano-Viera, E. (Estíbaliz)

Azkona, G. (Garikoitz)

Carvajal-Vergara, X. (Xonia)

Castaño, J. (Julio)

Giorgetti, A. (Alessandra)

Zabaleta, L. (Lorea)

English

Dadun, University of Navarra

Contents lists available at ScienceDirectStem Cell Researchjournal homepage: www.elsevier.com/locate/scrLab Resource: Multiple Cell LinesGeneration of two transgene-free human iPSC lines from CD133+ cordblood cellsEstibaliz Arellano-Viera1, Lorea Zabaleta, Julio Castaño2, Garikoitz Azkona3,Xonia Carvajal-Vergara⁎⁎,4,5, Alessandra Giorgetti⁎,2,5Inbiomed Foundation, San Sebastian, SpainA B S T R A C TWe have generated two human induced pluripotent stem cell (iPSC) lines from CD133+ cells isolated from umbilical cord blood (CB) of a female child using non-integrative Sendai virus. Here we describe the complete characterization of these iPSC lines: PRYDi-CB5 and PRYDi-CB40.Resource table.Unique stem cell linesidentifierPRYDi-CB5PRYDi-CB40Alternative names of st-em cell linesCBiPS1sv-4F-5CBiPS1sv-4F-40Institution Inbiomed Foundation (San Sebastian, Spain)Contact information ofdistributorA. Giorgetti, agiorgetti@cmrb.eu; X. Carvajal-Vergara,xcarvajal@unav.esType of cell lines iPSCsOrigin HumanCell Source Cord blood CD133+ cellsClonality ClonalMethod of reprogram-mingSendai virusMultiline rationale isogenic clonesGene modification NOType of modification N/AAssociated disease N/AGene/locus N/AMethod of modification N/AName of transgene or r-esistanceN/AInducible/constitutivesystemN/ADate archived/stock da-teMarch 2012Cell line repository/ba-nkCell lines registered at http://www.isciii.es/ISCIII/es/contenidos/fd-el-instituto/fd-organizacion/fd-estructura-directiva/fd-subdireccion-general-investigacion-terapia-celular-medicina-regenerativa/fd-centros-unidades/fd-banco-nacional-lineas-celulares/fd-lineas-celulares-disponibles/lineas-de-celulas-iPS.shtmlEthical approval Patient informed consent obtained by the EthicalCommittee of Clinical Investigation of Donostia Hospital(Approval no. 9/05)Resource utilityThese human iPSC lines were derived from umbilical cord CD133+cells using Sendai virus that is a negative sense, single strand RNA virusthat allows the generation of iPSCs without the transgene integration.These cells could be used as integration-free control iPSC lines.Resource detailsCD133 antigen is known as a stem cell marker for hematopoieticstem cells (HSCs) and progenitors, and is a valid substitute for CD34,commonly used for HSCs enrichment. Moreover, since CD133 is notexpressed in late hematopoietic progenitors, this allows for the selec-tion of a more homogeneous population enriched in HSC. Of note, CBCD133+ cells express a subset of pluripotency-associated genes (OCT4,https://doi.org/10.1016/j.scr.2019.101410Received 14 January 2019; Received in revised form 13 February 2019; Accepted 19 February 2019⁎ Correspondence to: Alessandra Giorgetti, Centro de Medicina Regenerativa de Barcelona (CMRB), Gran Via de l'Hospitalet 199, 08908 Barcelona, Spain.⁎⁎ Correspondence to: Xonia Carvajal-Vergara, Cell Therapy Program, Center for Applied Medical Research (CIMA), Av. Pío XII 55, 31008 Pamplona, Spain.E-mail addresses: xcarvajal@unav.es (X. Carvajal-Vergara), agiorgetti@cmrb.eu (A. Giorgetti).1 Current affiliation: Institut für experimentelle Stammzelltransplantation, Universitätsklinikum Würzburg, Institut für experimentelle Stammzelltransplantation,Würzburg, Germany.2 Current affiliation: Center of Regenerative Medicine (CMRB), Barcelona, Spain.3 Current affiliation: Parc de Recerca Biomèdica de Barcelona (PRBB), Barcelona, Spain.4 Current affiliation: Center for Applied Medical Research (CIMA), University of Navarra, Instituto de Investigación Sanitaria de Navarra, Pamplona, Spain.5 These authors contributed equally to this work.Stem Cell Research 36 (2019) 101410Available online 28 February 20191873-5061/ © 2019 The Authors. Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/).TA B CE F GD100 μm100 μmCBiPS40APCBiPS5Bright fieldCBiPS40CBiPS5100 μm100 μm50 μm50 μm50 μm 50 μmCBiPS5 CBiPS40TUJ1/DAPIAFP/DAPISMA/DAPITUJ1/DAPIAFP/DAPISMA/DAPI50 μm50 μm50 μm50 μm100 μm100 μm100 μm100 μmCBiPS5 CBiPS40AFP/DAPIGFAP/TUJ1/DAPITUJ1/ DAPIACTIN/SMA/DAPISMA/DAPIAFP/DAPIM E O XGene expressionrelave to day 0D ay  0D ay  1 602 04 06 08 01 0 0F O X A 2Gene expressionrelave to day 0D ay  0D ay  1 601 02 03 0N E U R O D 1Gene expressionrelave to day 0D ay  0D ay  1 601 02 03 04 0C B iP S 5C B iP S 4 0CBiPS40CBiPS5DAPI OCT4 SSEA3 OCT4/SSEA3100 μm100 μm100 μm100 μm100 μm100 μm100 μm100 μmFig. 1. Characterization of PRYDi-CB5 (CBiPS5) and PRYDi-CB40 (CBiPS40) human iPSC lines. A) A representative iPSC colony in bright field is shown. B)Analysis of the AP activity. C) Endogenous expression of pluripotency-associated genes (OCT4, SOX2, NANOG and ZFP42) by RT-qPCR. D) OCT4 and SSEA3immunostaining. Nuclei: DAPI. E) Gene expression analysis by RT-qPCR of NEUROD3 (ectoderm), MEOX (mesoderm), and FOXA2 (endoderm) in undifferentiated(day 0) and differentiated iPSC (day 14). F) TUJ1 (ectoderm), SMA (mesoderm) and AFP (endoderm) protein expression analysis by immunostaining in un-differentiated (day 0) and differentiated iPSC (day 14). Nuclei: DAPI. G) Immunofluorescence analysis of TUJ1/GFAP (ectoderm), ACTIN/SMA (mesoderm) and AFP(endoderm) proteins in teratomas derived from the two iPSC lines. Nuclei: DAPI.E. Arellano-Viera, et al. Stem Cell Research 36 (2019) 1014102SOX2, NANOG and CRIPTO), albeit at much lower levels than humanembryonic stem cells (HESCs) (Giorgetti et al., 2009). On the otherhand, the endogenous levels of cMYC and KLF4 are higher in CBCD133+ cells compared with other adult somatic cells. The combina-tion of low levels of pluripotency markers with the high levels of KLF4and c-MYC allow enhanced reprogramming of CB CD133+cells.CD133+ cells were isolated and infected with non-integrativeSendai virus vectors encoding OCT4, SOX2, KLF4, c-MYC. On day 3after infection, cells were transferred onto plates containing a layer ofirradiated mouse fibroblast feeders (MEFs) and cultured until humanpluripotent stem cells-like colonies were observed, approximately3 weeks post-infection. Colonies were manually picked for clonal ex-pansion. Multiple iPSC clones were generated and here we show thecharacterization of two of these established iPSC lines, PRYDi-CB5 andPRYDi-CB40. The short tandem repeats (STR) analysis confirmed thegenetic relatedness of both iPSC lines to their parental CB sample. TheseiPSC lines formed large and flat polygonal colonies of different shapeswith smooth edges (Fig. 1A) and showed a high alkaline phosphatase(AP) activity (Fig. 1B).Endogenous pluripotency-related transcription factors such OCT4,NANOG, SOX2 and ZFP42 were expressed (Fig. 1C). OCT4 transcriptionfactor was expressed in the nucleus and SSEA3 pluripotency-relatedantigen was present in the surface of the iPSCs, assessed by immuno-fluorescence (Fig. 1D). Established cell lines were karyotypicallynormal (Sup Fig. 1A) and mycoplasma free (Sup. Fig. 1B). These iPSClines have the potential to differentiate into cells of the three germlayers both in vitro and in vivo. Upon the in vitro differentiation of theseiPSC lines, using an embryoid body (EB) differentiation assay (Carvajal-Vergara et al., 2010), ectoderm (NEUROD1 or TUJ1), mesoderm(MEOX or SMA) and endoderm (FOXA2 or AFP) markers were ex-pressed, analyzed by RT-qPCR (Fig. 1E) or immunofluorescencestaining (Fig. 1F), respectively. These cell lines were able to developteratomas two months after their injection in NOD-SCID im-munodeficient mice, and the immunohistological staining analysisconfirmed that cells derived from the three germ layers such as TUJ1+/GFAP+ (ectoderm), ACTIN+/SMA+ (mesoderm) and AFP+ (en-doderm) were present (Fig. 1G).Materials and methodsGeneration of non-transgenic iPSCsCB CD133+ hematopoietic stem cells were isolated and cultivatedas described in Giorgetti et al., 2009. One hundred thousand cells weretransduced with CytoTune™-iPS 2.0 Sendai Reprogramming Kit (In-vitrogen) at 37 °C for 24 h in CD133+ growth medium containing 8 μg/mL polybrene. iPSCs were cultured on irradiated MEFs with KO-DMEM20% KSR medium supplemented with Glutamax, penicillin/strepto-mycin, non-essential aminoacids (all from Gibco), b-mercaptoethanol(Sigma-Aldrich) and 20 ng/mL of bFGF (Peprotech) in an incubatorwith 5% CO2 in air. The iPSC were passaged (1:6 ratio) every 5–6 daysusing 200 U/mL Collagenase IV (Gibco). After their characterization,these iPSC lines have also been adapted into feeder-free culture con-ditions at CIMA institute (Pamplona, Spain) and the iPSC lines can begrown on Corning Matrigel hESC-Qualified Matrix in mTeSR™1medium (STEMCELL Technologies). We regularly harvest iPSCs every4 days with TrypLE Express (Gibco) and seed approximately 300,000cells per well of a 6-multiwell plate in mTeSR™1 supplemented with Y-27632 (STEMCELL Technologies) at 10 μM (Tables 1 and 2).Cells were regularly tested for mycoplasma contamination byMycoAlert Mycoplasma Test (Lonza) and contaminations have not beendetected.STR analysisTo verify that human PRYDi-CB5 (CBiPS5) and PRYDi-CB40(CBiPS40) iPSC lines derived from their parental CB sample, we per-formed STR analysis of three loci (D10S1214, D17S1290 and D7S796).The genomic DNA (gDNA) was isolated with Easy-DNA™ kit(Invitrogen). The PCR amplification was performed using a total of50ng of gDNA per reaction, the Taq polymerase with Standard TaqBuffer (New England Biolabs) and the primers listed in Table 3. ThePCR conditions were as follows: 5 min at 94 °C, 35 x (5min at 94 °C,1min at 55 °C and 1min at 72 °C) and 7min at 72 °C. A 2.5% agarosegel was used to analyze PCR products. A positive control, gDNA fromthe parental CB sample and a negative control, gDNA from BJ fibro-blasts, was used.KaryotypingThe iPSCs were grown on a T75 flask without feeders. Chromosomalanalysis was performed in PRYDi-CB5 and PRYDi-CB40 at passage 8and 10, respectively, using the standard GTG-banding method at theGenetics Service (Policlínica Gipuzkoa, San Sebastián). 15 metaphasesper cell line were analyzed.Immunofluorescence (IF) staining and alkaline phosphatase (AP)The iPSCs or iPSC-derived differentiated cells were fixed with 4%paraformaldehyde for 15min at room temperature. Pluripotency-asso-ciated (OCT4, NANOG, SOX2, SSEA3 and TRA-1-60) and differentiation(TUJ1, SMA, AFP) markers staining was performed as previously de-tailed (Carvajal-Vergara et al., 2010). Cells were counterstained withDAPI (Sigma) and analyzed with Zeiss LSM510-META confocal laserscanning microscope. AP Blue Membrane Substrate Solution was usedfollowing the manufacturer's instructions (Sigma-Aldrich).Teramotas were fixed in 4% paraformaldehyde and embedded inparaffin. Slices of 5 um were obtained with a microtome. Antigen re-trieval was performed with citrate buffer and nonspecific labelling wasblocked in TBS 0.5% Triton blocking solution containing 3% donkeyserum. Primary antibodies were diluted in blocking solution and in-cubated for 24 h at 4 °C. After washing in TBS the sections were in-cubated with their corresponding secondary antibody for 2 h at 37 °C.Finally, sections were washed, counterstained with DAPI and cover-slipped with mounting medium.All the primary and secondary antibodies used in this study arereferenced in Table 3.RT-qPCRTotal RNA was prepared with the RNeasy Mini Kit (QIAGEN) andreverse transcribed with Superscript III (ThermoFisher). QuantitativePCR (qPCR) analysis was performed in the StepOnePlus™ Real-TimePCR System using the power SyBR PCR green Master Mix. Sequences ofpluripotency- and specific lineage-related markers primers are de-scribed in Table 3. The quantitative gene expression data wereTable 1Summary of lines.iPSC line names Abbreviation in figures Gender Age Ethnicity Genotype of locus DiseasePRYDi-CB5 CBiPS5 Female Newborn N/A N/A N/APRYDi-CB40 CBiPS40 Female Newborn N/A N/A N/AE. Arellano-Viera, et al. Stem Cell Research 36 (2019) 1014103normalized to expression levels of GAPDH housekeeping genes anderror bars indicate± s.d. of triplicates.In vitro and in vivo differentiationWe used the in vitro differentiation procedure described in Carvajal-Vergara et al., 2010. Briefly, iPSC colonies detached with collagenase IVwere disaggregated and dispersed into small clumps and cultured as EBsin iPSC medium without bFGF in ultra-low attachment plates (CorningInc.). On day 1 the media was changed and EBs were cultured inStemPro34 medium supplemented with Glutamax, Pen/Strep (all fromGibco), 50 μg/mL ascorbic acid, 150 μg/mL transferrin and 4×10−4 1-Thioglycerol (Sigma-Aldrich). On day 8 of differentiation, EBs wereplated on 0.1% gelatin coated dishes and cultured in DMEM 10% FBSsupplemented with Glutamax and Pen/Strep (all from Gibco) differ-entiation medium for 8 additional days before RNA collection for RT-Table 2Characterization and validation.Classification Test Result DataMorphology Bright field normal Fig. 1APhenotype AP Activity shown Fig. 1BRT-qPCR Expression of endogenous pluripotency markers OCT4, SOX2,NANOG, ZFP42Fig. 1CImmunofluorescence (IF) staining. Positive staining for SSEA3 and OCT4 Fig. 1DGenotype Karyotype 46 XXResolution: 400 bpsSup. Fig.1AIdentity STR analysis 3 loci tested, all matched Available with the AuthorsMutation analysis (IF APPLICABLE) Southern Blot OR WGS N/A N/AMicrobiology and virology Mycoplasma Mycoplasma testing by luminescence Negative Sup. Fig.1BDifferentiation potential Embryoid body formation Expression of germ layer markers:Ectoderm: NEUROD3 (RT-qPCR); TUJ1 (IF)Mesoderm: MEOX (RT-qPCR); SMA (IF)Endoderm: FOXA2 (RT-qPCR); AFP (IF)Fig. 1EFig. 1FTeratoma formation Expression of germ layer markers (IF):Ectoderm: GFAP, TUJ1Mesoderm: ACTIN, SMAEndoderm: AFPFig. 1GDonor screening (OPTIONAL) HIV 1+2 Hepatitis B, Hepatitis C N/A N/AGenotype additional info (OPTIONAL) Blood group genotyping N/A N/AHLA tissue typing N/A N/ATable 3Reagents details.Antibodies used for immunocytochemistry/flow-cytometryAntibody Dilution Company Cat # and RRIDPluripotency markers Rabbit anti-OCT4 1:200 BioVision Cat#3576-100 RRID#AB_2167563Rabbit anti-SOX2 1:75 Thermo Fisher Scientific Cat#PA1-16968 RRID#AB_2195781Goat anti-NANOG 1:50 Everest Biotech Cat#EB06860 RRID#AB_2150379Rat anti-SSEA3 1:4 Hyrbridoma Bank Cat#MC-631 RRID#AB_528476Mouse IgM anti-TRA-1-60 1:200 Thermo Fisher Scientific Cat#14-8863-80 RRID#AB_891612Lineage-specific markers of the three germ layers Rabbit anti-AFP 1:400 Agilent Cat#A0008 RRID#AB_2650473Rabbit anti-GFAP 1:500 Agilent Cat#Z0334 RRID#AB_10013382Mouse anti-TUJ1 1:500 Covance Research Products Inc. Cat#MMS-435P RRID#AB_2313773Mouse IgG2a anti-SMA 1:400 Sigma-Aldrich Cat#A5228 RRID#AB_262054Mouse IgM anti-ACTIN 1:400 Sigma-Aldrich Cat#A2172 RRID#AB_476695Secondary antibodies Alexa Fluor 546 Goat anti-Rabbit 1:1000 Thermo Fisher Scientific Cat#A-11035 RRID#AB_2534093Alexa Fluor 488 Donkey anti-Goat 1:500 Thermo Fisher Scientific Cat#A-11055 RRID#AB_142672Alexa Fluor 488 Goat anti-Rat 1:500 Thermo Fisher Scientific Cat#A-11006 RRID#AB_2534074Alexa Fluor 488 Goat anti-Mouse IgM 1:500 Thermo Fisher Scientific Cat#A-21042 RRID#AB_2535711Alexa Fluor 488 Donkey anti-Rabbit 1:500 Thermo Fisher Scientific Cat#A-21206 RRID#AB_2535792Cy™3 Donkey anti-Mouse 1:500 Thermo Fisher Scientific Cat#A-11035 RRID#AB_2534093PrimersTarget (product size) Forward/Reverse primer (5′-3′)Pluripotency markers (qPCR) OCT4 (123 bp) AACCTGGAGTTTGTGCCAGGGTTT/TGAACTTCACCTTCCCTCCAACCASOX2 (150 bp) AGAAGAGGAGAGAGAAAGAAAGGGAGAGA/GAGAGAGGCAAACTGGAATCAGGATCAAANANOG (190 bp) CCTGAAGACGTGTGAAGATGAG/GCTGATTAGGCTCCAACCATACZFP42 (267 bp) AAAGCATCTCCTCATTCATGGT/TGGGCTTTCAGGTTATTTGACTDifferentiation markers (qPCR) NEUROD1 (200 bp) CCCATGGTGGGTTGTCATATATTCATGT/CCAGCATCACATCTCAAACAGCACMEOX (171 bp) TGGAAGCGTGTGAAGGGAGGT/AAGGAAGAGGGTGAAGGTGGGATTGFOXA2 (107 bp) GCATTCCCAATCTTGACACGGTGA/GCCCTTGCAGCCAGAATACACATTHouse-Keeping Genes (qPCR) GAPDH (87 bp) TGCACCACCAACTGCTTAGC/GGCATGGACTGTGGTCATGAGIdentity (PCR) D10S1214 ATTGCCCCAAAACTTTTTTG/TTGAAGACCAGTCTGGGAAGD17S1290 GCCAACAGAGCAAGACTGTC/GGAAACAGTTAAATGGCCAAD7S796 TTTTGGTATTGGCCATCCTA/GAAAGGAACAGAGAGACAGGGE. Arellano-Viera, et al. Stem Cell Research 36 (2019) 1014104qPCR or cell fixation for immunostaining analyses.To test the in vivo differentiation capability of iPSCs, one millioncells were harvested with TrypLE, suspended in 100 ul of 50% (v/v)Matrigel (Corning) and 50% (v/v) PBS and injected intratesticularly inan 8-week old NOD-SCID mouse. Teratoma formation was observedafter 2months of infusion. The teratoma was sectioned and stained.AcknowledgementThis work was supported by the “Ramón y Cajal” State Program,Ministry of Economy and Competitiveness (MINECO, RYC-2012-10981)to XCV; the “Retos de la Sociedad” State Program, MINECO SAF2016-79398-R (AEI/FEDER, UE) to XCV; and by the Basque Government,Department of Industry (SAIOTEK PE12IB003) and Obra Social Kutxato AG.Appendix A. Supplementary dataSupplementary data to this article can be found online at https://doi.org/10.1016/j.scr.2019.101410.ReferencesCarvajal-Vergara, X., Sevilla, A., Dsouza, S.L., et al., 2010. Patient-specific inducedpluripotent stem-cell-derived models of LEOPARD syndrome. Nature. https://doi.org/10.1038/nature09005.Giorgetti, A., Montserrat, N., Aasen, T., et al., 2009. Generation of induced pluripotentstem cells from human cord blood using OCT4 and SOX2. Cell Stem Cell 5, 353–357.E. Arellano-Viera, et al. Stem Cell Research 36 (2019) 1014105

Generation of two transgene-free human iPSC lines from CD133+ cord blood cells

https://dadun.unav.edu/bitstream/10171/62171/1/1-s2.0-S1873506119300406-main.pdf

Generation of two transgene-free human iPSC lines from CD133+ cord blood cells

Abstract

Similar works

Full text

Available Versions

Dadun, University of Navarra