A non-synonymous single nucleotide polymorphism (SNP) underlies a diallelic allozyme polymorphism at the mitochondrial NADP-dependent mMEP-2* locus in Atlantic salmon (\textit{Salmo salar} L.). The resultant amino acid substitution, which alters the charge of the allelic products, matches the differential mobility of the two allozyme alleles, while allozyme and SNP assays revealed genotyping concordance in 257 of 258 individuals. A single mismatch, homozygous allozyme vs heterozygote SNP, suggests the presence of a second, less common null allele

Bekaert, Michaël

Leaver, Michael J

Taggart, John B

PubMed

Stirling Online Research Repository (RIOXX)

B R I E F C OMMUN I C A T I O NDNA polymorphism underlying allozyme variation at a malicenzyme locus (mMEP-2*) in Atlantic salmon (Salmo salar L.)John B. Taggart | Michael J. Leaver | Michaël BekaertInstitute of Aquaculture, Faculty of NaturalSciences, University of Stirling, Stirling,Scotland, UKCorrespondenceMichaël Bekaert, Institute of Aquaculture,Faculty of Natural Sciences, University ofStirling, Stirling, UK.Email: michael.bekaert@stir.ac.ukFunding informationUniversity of Stirling APC fundAbstractA non-synonymous single nucleotide polymorphism (SNP) underlies a diallelicallozyme polymorphism at the mitochondrial NADP-dependent mMEP-2* locus inAtlantic salmon (Salmo salar L.). The resultant amino acid substitution, which altersthe charge of the allelic products, matches the differential mobility of the twoallozyme alleles, whereas allozyme and SNP assays revealed genotyping concordancein 257 of 258 individuals. A single mismatch, homozygous allozyme vs. heterozygoteSNP, suggests the presence of a second, less common null allele.K E YWORD Sallozyme, malic enzyme, population, selection, SNPThe study of loci under selection can shed light on adaptive evolution-ary processes and may be particularly informative for populationdelineation and management (Powers & Schulte, 1998; Watt, 1994).The nuclear DNA encoded mitochondrial NAPD-dependent malicenzyme locus mMEP-2* in Atlantic salmon, Salmo salar L., exhibits adiallelic allozyme polymorphism (alleles *100 and *125), which is vari-able throughout the species' geographic range (Bourke et al., 1997).A number of population-based studies have highlighted mMEP-2*allele and genotype frequencies that are indicative of a selectionsignal (e.g. Gilbey et al., 1999; Jordan et al., 1990, 1997; Moranet al., 1998; Verspoor & Jordan, 1989). Further research has stalled,however, with population genetic studies now using direct DNAmarker screening platforms. To prime further research into mMEP-2*the authors report on the identification of a causal SNP (accessionss9410532730) for the observed mMEP-2* allozyme polymorphismand the development of simple rapid DNA-based assays to survey it.Frozen skeletal muscle tissues for both allozyme and DNA screen-ing were opportunistically acquired from archived materials, collectedover a 19-year period (1997–2015) from a range of unrelatedprojects. These comprised 258 individuals (including pedigree parentsdetailed later) from six different sources: two rivers (Dee and Tay,Scotland n = 36 and 32, respectively), three commercial Europeanfarm strains (n = 50, 40 and 40) and a ranch strain (Burrischoole,Ireland n = 60). In addition, archived DNA samples from wildpopulations inhabiting the latitudinal limits of the species range werealso surveyed: two rivers from Finnmark, Norway (n = 46 each;Kongsfjordelva and Repparfjordelva) and two rivers from northernSpain (n = 30 each; Rio Ulla and Rio Bidasoa). Sampling wasconducted according to national regulations in place at the time thespecimens were taken.The gene search focused on archived DNAs from two S. salarmapping panels (Br5 and Br6) originally generated from anEU-funded linkage mapping project (SALMAP, 1997–2000). Thesalmon families interrogated were outcrosses involving fourwild-caught adults (River Tay, Scotland), each pedigree comprisingsire, dam and 48 progeny. Three allozyme loci, including mMEP-2*,were found among the c. 350 markers, mostly short tandem repeats(STRs), assigned to a low-resolution map based on these pedigrees(Danzmann et al., 2005).Starch gel electrophoresis of skeletal muscle extracts resolvesthree phenotypes, indicative of polymorphism at mMEP-2* involvingtwo alleles (*100 and *125; Figure 1a) as previously described(Cross et al., 1979). Variability at mMEP-2* proved to be informativefor both pedigrees (Br5 – sire *100/*125  dam *100/*100; Br6 –male *100/*125  *100/*125). Screening of the progeny confirmedMendelian inheritance in both pedigrees.Received: 2 June 2022 Accepted: 26 July 2022DOI: 10.1111/jfb.15182FISHThis is an open access article under the terms of the Creative Commons Attribution License, which permits use, distribution and reproduction in any medium,provided the original work is properly cited.© 2022 The Authors. Journal of Fish Biology published by John Wiley & Sons Ltd on behalf of Fisheries Society of the British Isles.J Fish Biol. 2022;1–4. wileyonlinelibrary.com/journal/jfb 1The preliminary search for MEP genes was conducted in 2012.Using malic enzyme vertebrate homologue sequences (mouse andzebrafish) as a starting point, NCBI and EBI databases (plus salmonidTIGR and GRASP EST repositories – no longer accessible) were inter-rogated to identify potentially relevant mRNA sequences in S. salar.For clarity, the gene locations and mRNA sequences for S. salarreported here are referenced to the latest (May 2022) Atlantic salmongenome assembly (Ssal_v3.1, NCBI; RefSeq GCF_905237065.1), andgenes are referred to by allozyme nomenclature. Multiple BLASTn/xanalyses identified two main mitochondrial-type MEP mRNAs(XM_014164545.2 and XM_014174329.2) and their genes identified(LOC106581960, on chromosome 21 and LOC106586750 on chro-mosome 25, respectively). These were assumed to represent theexpected duplicate pair of mMEP* enzyme loci. Using a draughtgenome, kindly provided by Ben Koop, STR loci located within intronicregions of both genes were identified and screened in the pedigrees(see Supporting Information Table S1 for details). Independent segre-gation (P = 0.8) was found between the LOC106581960 STR andmMEP-2*. In contrast, there was complete co-segregation betweenLOC106586750 STR alleles and mMEP-2* alleles (i.e., zero recombi-nants among the 96 progeny), identifying LOC106586750 as themMEP-2* gene, whereas LOC106581960 is likely to be mMEP-1*.The mMEP-2* gene (30,884 bp) comprises 15 identified exons(3853 bp), with the amino acid coding sequence (CDS) comprising614 codons – spanning mid-exon 2 to mid-exon 15. A set of eightPCR assays were devised to allow sequencing of the entire CDSregion (Supporting Information Table S2). Full CDS sequencing of twoprogeny from family Br6 (alternate allozyme homozygotes *100/*100and *125/*125) was undertaken. Only a single point mutationdifference in the CDS was found between the two individuals, a non-synonymous A!G substitution (*100 and *125 alleles, respectively) inexon 10 (position 1273 of XM_014174329.2; Supporting InformationFigure S1). This produces a charge-changing amino acid replacementat codon 371 – asparagine (N, no charge; *100 allele) for aspartic acid(D, negative charge; *125 allele), consistent with faster electrophoreticmovement of the *125 allele products towards the positive pole.The mutation sits within the NADP+ binding domain of the enzyme.This polymorphism has been captured in accessions, the amino acidsubstitution being the only difference between the original proteinreference sequences XP_014029804.1 (D) and its recently updatedreplacement XP_014029804.2 (N).The identified SNP (NC_059466.1:40628412:A:G, SNP accessionss9410532730) occurs within the restriction site of restrictionenzyme BsaH1, allowing RFLP-based detection, e.g., using the exon8–10 primer set (Table 1). The SNP “A” base disrupts the restrictionenzyme site (no cutting), whereas the “G” base permits restriction,yielding 1004 and 177 bp products (Figure 1b). A fluorescent allele-specific PCR assay (KASP; LGC Genomics) was also designed as arapid screening tool (Figure 1c; Table 2).In total 258 individuals from six different populations/stockswere screened for both allozyme and SNP variability (identifying61, 124 and 73 as *100/*100, *100/*125 and *125/*125 allozyme“genotypes,” respectively). Polymorphism was observed in all sixstocks. There was almost complete concordance between allozymeand SNP scoring (257 of 258 individuals). A single fish was scored as*100/*100 for allozyme and AG with both RFLP and KASP assay.The entire CDS of this individual was sequenced, confirming the AGgenotype. No other sequence differences were found. A null allele,caused by mutation in a regulatory gene region, could account forthis observation.Four population samples from both latitudinal range extremeswere screened for SNP variability. Contrasting frequencies for the“A” allele (*100) were observed between northern samples(f(A) = 0.48 and 0.33; Kongsfjordelva and Repparfjordelva,(a) (b) (c)origin mMEP-1*mMEP-1* (100)mMEP-2* (125)cMEP-3*,4*1 2 31,181 bp1,004 bp177 bpAA GG AG LAAGGAGFAM fluorescenceHEX fluorescenceF IGURE 1 Screening of MEP-2* polymorphism. (a) Starch gel zymogram of muscle extract, 1 = *100/*100; 2 = *100/*125; 3 = *125/*125;(b) SNP RFLP analysis, BsaHI digests of exon 8–10 amplicons (small 177 bp band usually very weak); (c) KASP assay, plot of fluorescentlytagged allelesTABLE 1 RFLP assay primer details. Amplicon size: 1181 bp, PCRprimer annealing temperature: 62CName Primer Sequence (50 ! 30)Ex8-10.F TTTGACTATCTGACCGACCGTTCACEx8-10.R CTCGCCTTAATAGGTGTGCGTTTCT2 TAGGART ET AL.FISHrespectively) and southern samples (f(A) = 1.00 and 0.67; Ulla andBidasoa, respectively).Converting targeted allozyme polymorphisms to DNA-basedassays has many practical advantages. Integration with high through-put modern screening platforms is made possible, sample storage issimplified and ethical concerns relating to large-scale surveys can beaddressed through non-invasive sampling. Furthermore, temporalstudies can be expanded by both screening of curated samples andthe assimilation of existing allozyme datasets. The approach has beenused for salmonid studies in the past (e.g., Brunelli et al., 2008;McMeel et al., 2001).With genomic resources for species expanding at a rapid rate, theidentification of DNA mutations underlying allozyme variation isbecoming more straightforward. In the current study, the use ofmapping pedigrees to confidently distinguish between duplicate lociwas particularly helpful. The sole point mutation within the CDS ofalternate allozyme homozygote sibs, causing a charge changing aminoacid substitution matching electrophoretic expectations, is compellingevidence that this is a causal SNP. Furthermore, there was extremelyhigh concurrence between allozyme and SNP assays from the sameindividuals (>99.5%), and similar allele frequency disparity wasobserved for both SNP assay (this study) and allozyme assay(Verspoor et al., 2005) among populations from extremes of theS. salar latitudinal range. Both observations lend support for the SNPpolymorphism being a robust proxy for previously reported mMEP-2*allozyme polymorphism.A single mismatch, homozygous allozyme vs. heterozygote SNPgenotype, was observed. This could be indicative of an additional lowfrequency “null” allele, which could potentially generate a false selec-tion signal in samples, if present at a higher frequency. Nonetheless, anull allele, which should lead to an overestimation of homozygotenumbers, would not clearly explain the excess of allozyme heterozy-gotes found among grilse reported by Jordan et al. (1990). Furtherwork is needed to clarify this issue. There is a large array of potentialregulatory mechanisms that can underlie null alleles (Rojanoet al., 2019), which can be extremely difficult to identify solely fromDNA sequence data (e.g., Saha et al., 2022).This characterised DNA polymorphism and assay will allow formore intensive work into the widely suspected selective action atmMEP-2*. As well as the single locus assays described above, itshould be straightforward to include this assay into existing bespokeSNP panels used routinely for population and pedigree screening, andit is already represented multiple times on an existing Atlantic salmonhigh-density genotyping array (Houston et al., 2014).AUTHOR CONTRIBUTIONSJ.B.T.: conception, data generation, data analysis and manuscriptpreparation. M.J.L. and M.B: data analysis and manuscriptpreparation.ACKNOWLEDGEMENTSWe thank Ben Koop, University of Victoria (Canada), for access to apre-published draught Atlantic salmon genome and Paulo Prodöhl,Queen's University (Northern Ireland), Kevin Glover, Institute ofMarine Research (Norway), and Paloma Moran, Universidade de Vigo(Spain) for supplying archived samples.FUNDING INFORMATIONThis research did not receive any specific grant from funding agen-cies in the public, commercial or not-for-profit sectors. The fees forarticle processing charges were covered by the University of StirlingAPC fund.CONFLICT OF INTERESTThe authors declare no conflict of interest.ETHICAL STATEMENTNo samples were specifically collected for this project, and archivedmaterial was repurposed. Sampling was conducted according tonational regulations in place at the time the specimens were taken.Abidance to animal welfare laws, guidelines and policies as approvedby University of Stirling Ethics Committee (Animal Welfare and EthicsReview Board; AWERB 2022 5001 6348).ORCIDJohn B. Taggart https://orcid.org/0000-0002-3843-9663Michael J. Leaver https://orcid.org/0000-0002-3155-0844Michaël Bekaert https://orcid.org/0000-0002-1206-7654REFERENCESBourke, E. A., Coughlan, J., Jansson, H., Galvin, P., & Cross, T. F. (1997).Allozyme variation in populations of Atlantic salmon located through-out Europe: Diversity that could be compromised by introductions ofreared fish. ICES Journal of Marine Science, 54(6), 974–985.TABLE 2 KASP allele-specific primerdetailsName Primer sequence (50 ! 30)a Fluorescent tailF_MEP2.A gaaggtgaccaagttcatgctGGAGGGAGTGTCCGCCACAA FAMF_MEP2.G gaaggtcggagtcaacggattGAGGGAGTGTCCGCCACAG HEXR_MEP2 GATTAGCTATGATATTATGGTATTGCAGTTNote. Amplicon size: 146 bp (including tails; PCR primer annealing temperature: 65C!57C(Touchdown, KASP standard protocol).aBases in uppercase letters are locus specific, whereas lowercase tails allow for incorporation of thecomplementary fluorescent tags present in the KASP mastermix.TAGGART ET AL. 3FISHBrunelli, J. P., Thorgaard, G. H., Leary, R. F., & Dunnigan, J. L. (2008).Single-nucleotide polymorphisms associated with allozyme differencesbetween inland and coastal rainbow trout. Transactions of the AmericanFisheries Society, 137(5), 1292–1298.Cross, T. F., Ward, R. D., & Abreu-Grobois, A. (1979). Duplicate loci andallelic variation for mitochondrial malic enzyme in the Atlantic salmon,Salmo salar l. Comparative Biochemistry and Physiology Part B: Compara-tive Biochemistry, 62(4), 403–406.Danzmann, R. G., Cairney, M., Davidson, W. S., Ferguson, M. M.,Gharbi, K., Guyomard, R., … Woram, R. A. (2005). A comparative analy-sis of the rainbow trout genome with 2 other species of fish (Arcticcharr and Atlantic salmon) within the tetraploid derivative Salmonidaefamily (subfamily: Salmoninae). Genome, 48(6), 1037–1051.Gilbey, J., Verspoor, E., & Summers, D. (1999). Size and MEP-2* variationin juvenile Atlantic salmon (Salmo salar) in the river North Esk,Scotland. Aquatic Living Resources, 12(4), 295–299.Houston, R. D., Taggart, J. B., Cézard, T., Bekaert, M., Lowe, N. R.,Downing, A., … Hamilton, A. (2014). Development and validation of ahigh density SNP genotyping array for Atlantic salmon (Salmo salar).BMC Genomics, 15(1), 90.Jordan, W. C., Verspoor, E., & Youngson, A. F. (1997). The effect of naturalselection on estimates of genetic divergence among populations ofthe Atlantic salmon. Journal of Fish Biology, 51(3), 546–560.Jordan, W. C., Youngson, A. F., & Webb, J. H. (1990). Genetic variation atthe malic enzyme-2 locus and age at maturity in sea-run Atlanticsalmon (Salmo salar). Canadian Journal of Fisheries and Aquatic Sciences,47(9), 1672–1677.McMeel, O. M., Hoey, E. M., & Ferguson, A. (2001). Partial nucleotidesequences, and routine typing by polymerase chain reaction-restriction fragment length polymorphism, of the brown trout (Salmotrutta) lactate dehydrogenase, LDH-C1*90 and *100 alleles. MolecularEcology, 10(1), 29–34.Moran, P., Perez, J., & Garcia-Vazquez, E. (1998). The malic enzymeMEP-2* locus in Spanish populations of Atlantic salmon: Sea age andforeign stocking. Aquatic Sciences, 60(4), 359–366.Powers, D. A., & Schulte, P. M. (1998). Evolutionary adaptations of genestructure and expression in natural populations in relation to a changingenvironment: A multidisciplinary approach to address the million-yearsaga of a small fish. The Journal of Experimental Zoology, 282(1–2), 71–94.Rojano, E., Seoane, P., Ranea, J. A. G., & Perkins, J. R. (2019). Regulatoryvariants: From detection to predicting impact. Briefings in Bioinformat-ics, 20(5), 1639–1654.Saha, A., Andersson, A., Kurland, S., Keehnen, N. L. P., Kutschera, V. E.,Hössjer, O., … Laikre, L. (2022). Whole-genome resequencing confirmsreproductive isolation between sympatric demes of brown trout (Salmotrutta) detected with allozymes.Molecular Ecology, 31(2), 498–511.Verspoor, E., Beardmore, J. A., Consuegra, S., Garcia de Leaniz, C.,Hindar, K., Jordan, W. C., … Cross, T. F. (2005). Population structure inthe Atlantic salmon: Insights from 40 years of research into geneticprotein variation. Journal of Fish Biology, 67(s1), 3–54.Verspoor, E., & Jordan, W. C. (1989). Genetic variation at the Me-2 locusin the Atlantic salmon within and between rivers: Evidence for itsselective maintenance. Journal of Fish Biology, 35, 205–213.Watt, W. B. (1994). Allozymes in evolutionary genetics: Self-imposedburden or extraordinary tool? Genetics, 136(1), 11–16.SUPPORTING INFORMATIONAdditional supporting information can be found online in the Support-ing Information section at the end of this article.How to cite this article: Taggart, J. B., Leaver, M. J., & Bekaert,M. (2022). DNA polymorphism underlying allozyme variationat a malic enzyme locus (mMEP-2*) in Atlantic salmon (Salmosalar L.). Journal of Fish Biology, 1–4. https://doi.org/10.1111/jfb.151824 TAGGART ET AL.FISH

DNA polymorphism underlying allozyme variation at a malic enzyme locus (mMEP-2*) in Atlantic salmon (Salmo salar L.)

A non‐synonymous single nucleotide polymorphism (SNP) underlies a diallelic allozyme polymorphism at the mitochondrial NADP‐dependent mMEP‐2* locus in Atlantic salmon (Salmo salar L.). The resultant amino acid substitution, which alters the charge of the allelic products, matches the differential mobility of the two allozyme alleles, whereas allozyme and SNP assays revealed genotyping concordance in 257 of 258 individuals. A single mismatch, homozygous allozyme vs. heterozygote SNP, suggests the presence of a second, less common null allele

Taggart, John B.

Leaver, Michael J.

PubMed Central

DNA polymorphism underlying allozyme variation at a malic enzyme locus (mMEP‐2*) in Atlantic salmon (Salmo salar L.)

A non-synonymous single nucleotide polymorphism (SNP) underlies a diallelic allozyme polymorphism at the mitochondrial NADP-dependent mMEP-2* locus in Atlantic salmon (\textit{Salmo salar} L.). The resultant amino acid substitution, which alters the charge of the allelic products, matches the differential mobility of the two allozyme alleles, while allozyme and SNP assays revealed genotyping concordance in 257 of 258 individuals. A single mismatch, homozygous allozyme vs heterozygote SNP, suggests the presence of a second, less common null allele.Output Status: Forthcoming/Available Onlin

Stirling Online Research Repository

http://dspace.stir.ac.uk/retrieve/570ed03a-dd10-47f1-b071-add0e176cd53/Journal%20of%20Fish%20Biology%20-%202022%20-%20Taggart%20-%20DNA%20polymorphism%20underlying%20allozyme%20variation%20at%20a%20malic%20enzyme%20locus%20mMEP___2%20.pdf

DNA polymorphism underlying allozyme variation at a malic enzyme locus (mMEP-2*) in Atlantic salmon (Salmo salar L.)

Abstract

Similar works

Full text

Available Versions

Stirling Online Research Repository (RIOXX)

PubMed Central

Stirling Online Research Repository