Calvo Bizarro, Eric

Universitat Autònoma de Barcelona. Facultat de Biociències

English

Diposit Digital de Documents de la UAB

This is the published version of the bachelor thesis:Calvo Bizarro, Eric. Utilization of conjugative CRISPR. 2021. 1 pag. (816 Grauen Microbiologia)This version is available at https://ddd.uab.cat/record/248134under the terms of the licenseUtilization of conjugative CRISPR/Cas9 system to eliminate antibiotic resistance plasmids in Pseudomonas aeruginosaEric Calvo BizarroBachelor’s Degree in Microbiology (4th year), Universitat Autònoma de Barcelona - Research ProjectPseudomonas aeruginosaTo construct a conjuga-ve plasmid with CRISPR/Cas9 technology and another one used as nega-ve controlTo validate the constructed plasmid’s ability to conjugate and re-sensi-zeTo validate the constructed system to limit HGTTo assess in vivo the conjuga-ve CRISPR/Cas9 system ac-vityA single conjuga-ve plasmid with CRISPR/Cas9 system could be used as a strategy to cure an-bio-c resistance plasmids and prevent their acquisi-on in P. aeruginosa.REFERENCESo It will be demonstrated if pCRISPR-Conj is able to conjugate and cure an7bio7c resistanceplasmids in vitro and in vivoà ~90% of curing efficiencyo It will be shown whether pCRISPR-Conj limits HGTà 100-500-fold reduc7on in conjuga7onfrequencyo Future applica7ons of the constructed system:• Reduce therapy’s limita1on and prolong theeffec1ve lifespan of conven1onal an1bio1cs• Cut down the exposure of pa1ents to an1bio1cs• It would not be necessary to look into newan1bio1cs• Reduce an1bio1c resistant P. aeruginosa in thehuman skin microbiota and in water-reservoirs• Decrease the amount of an1bio1c resistant P.aeruginosa from water-reservoirsEXPECTED RESULTS DISSEMINATION PLANo Publica7on of the methodology and results in renowned scien-ficjournals related to gene-c engineering, medical research andan-microbial resistanceso Presenta7on via poster at relevant na-onal and interna-onal conferencesRECIPIENT BACTERIAcrpPpUM505 pAKD1sul1DONOR BACTERIADONOR BACTERIA2 different conjugaBon assayspCRISPR-NonTransArray of sgRNAs, csy4 and cas9oriVTcRKmRtragenesoriT3. HGT limita*on assayRECIPIENT BACTERIApCRISPR-ConjArray of sgRNAs, csy4  and cas9oriVTcRKmRtragenesoriTCas9blaVIM-1 sgRNApAMBL2Elimina1on of pAMBL2 and re-sensi1za1on2. Curing assaySELECTIONpSQT1313Csy4 siteCsy4 sitesgRNA scaffoldo One of the most common bacteria related to nosocomial infectionso Worldwide public health threat due to the appearance of antibioticresistanceso Intrinsic, adaptive and acquired mechanisms that confer resistanceso Acquisition of antibiotic resistance genes via horizontal gene transfer(HGT), being conjugation the most predominant mechanismsgRNADNACas9CRISPR/Cas9 systemFig. 1. Schema(c representa(on of CRISPR/Cas9technology.o Adap7ve immune system of prokaryoteso 2 main components:• Cas9 à Endonuclease• Single guide RNA (sgRNA) à Fusion oftrans-ac-va-ng crRNA and CRISPR RNAo Poten-al tool to cure an7bio7c resistance plasmidsFig. 5..NaCland 1 h pos1nfec1onand 1 h pos1nfec1onpAMBL2 pAMBL2 pAMBL2pCas9pCRISPR-ConjKanamycin, tetracycline and meropenemKanamycin and tetracycline1. Plasmids construc*onsTcRoriVApRtragenespCRISPR-ConjKmRoriTDiges7on of the assembled product and RK2 plasmid, which acts as backbone, and liga-on 1.G. 4. In vivo assessmentFig. 2. Scheme of the procedure toconstruct pCRISPR-Conj and pCas9.csy4EcoRI J23119 promoterJ23119 promoterJ23119 promoterJ23119 promoterCsy4 siteCsy4 siteCsy4 siteCsy4 sitesul1 sgRNAcas9 BamHIblaVIM-1sgRNA1.D. Gibson Assembly of the overlapping fragments previously obtainedIndividual amplifica-ons of J23119 promoters, sgRNAs with Csy4 sites, csy4 and cas9 by PCRto add overlapping sequences  1.E. 5’ GACACTTCAACGATCCCCACCGG 3’PAM pSQT1313sgRNA scaffoldCsy4 siteCsy4 site1.A. 1.B. Iden7fica7on of the target sequences with PAM located downstreamSynthesis of target sequences with complementary overhangs to sticky ends of pSQT1313 Liga7on of the targets sequences into different digested pSQT1313 plasmids1.C. Genera7on of pCas9, which will be used as nega-ve control1.F. Fig. 3. Representa(on of plasmidcuring assay with the conjuga(veCRISPR/Cas9 system.blaVIM-1Fig. 4. Scheme of HGTlimita(on assay.Fig. 5. Representationof in vivo assessmentof the conjugativeCRISPR/Cas9 system.INTRODUCTIONHYPOTHESIS AND OBJECTIVESMATERIAL AND METHODSKanamycin and tetracyclineKanamycin, tetracycline and meropenem1. Pang Z, Raudonis R, Glick BR, Lin TJ, Cheng Z. An:bio:c resistance in Pseudomonas aeruginosa: mechanismsand alterna:ve therapeu:c strategies. Biotechnol Adv. 2019;37(1):177–92.doi:10.1016/j.biotechadv.2018.11.013 2. Gholizadeh P, Köse Ş, Dao S, Ganbarov K, Tanomand A, Dal T, et al. HowCRISPR-Cas system could be used to combat an:microbial resistance. Infect Drug Resist. 2020;13:1111–21.doi:10.2147/idr.s247271 3. Kim JS, Cho DH, Park M, Chung WJ, Shin D, Ko KS, et al. Crispr/cas9-mediated re-sensi:za:on of an:bio:c-resistant escherichia coli harboring extended- spectrum β-lactamases. J MicrobiolBiotechnol. 2015;26(2):394–401. doi:10.4014/jmb.1508.08080. Images created with BioRender.com.

Utilization of conjugative CRISPR/Cas9 system to eliminate antibiotic resistance plasmids in Pseudomonas aeruginosa

https://ddd.uab.cat/pub/tfg/2021/248134/CalvoBizarro_Eric.pdf

Utilization of conjugative CRISPR/Cas9 system to eliminate antibiotic resistance plasmids in Pseudomonas aeruginosa

Abstract

Similar works

Full text

Available Versions

Diposit Digital de Documents de la UAB