Fifteen microsatellite markers were isolated
from an enriched microsatellite library developed specifically for Pringleophaga marioni, a flightless moth species from the sub-Antarctic Prince Edward Islands. Of these, 12 markers were polymorphic in a population of 44 individuals collected on Marion Island. Between 2 and 7 alleles
were amplified per marker and the expected heterozygosities (HE) for these ranged from 0.046 to 0.753. These microsatellite markers reported here are the first for P. marioni and will be used to investigate conservation
genetic aspects of this species on the Prince Edward
Islands

Born, C.

Chown, S.L.

Groenewald, C.W.

Janse van Rensburg, B.

Stellenbosch University SUNScholar Repository

TECHNICAL NOTEDevelopment of a microsatellite library for the flightless mothPringleophaga marioni Viette (Lepidoptera: Tineidae)C. W. Groenewald • C. Born • S. L. Chown •B. Jansen van VuurenReceived: 20 October 2010 / Accepted: 28 October 2010 / Published online: 16 November 2010 Springer Science+Business Media B.V. 2010Abstract Fifteen microsatellite markers were isolatedfrom an enriched microsatellite library developed specifi-cally for Pringleophaga marioni, a flightless moth speciesfrom the sub-Antarctic Prince Edward Islands. Of these, 12markers were polymorphic in a population of 44 individ-uals collected on Marion Island. Between 2 and 7 alleleswere amplified per marker and the expected heterozygos-ities (HE) for these ranged from 0.046 to 0.753. Thesemicrosatellite markers reported here are the first for P.marioni and will be used to investigate conservationgenetic aspects of this species on the Prince EdwardIslands.Keywords Flightless moth  Microsatellite  Fiascomethod  Sub-Antarctic  Marion IslandPringleophaga marioni, a species endemic to the PrinceEdward Islands (Marion and Prince Edward Island), is oneof three flightless tineid Lepidoptera found exclusively onislands of the sub-Antarctic (Crafford et al. 1986). Prin-gleophaga marioni is characterized by several unique andunusual traits compared to other lepidopteran species,probably as a result of limited predation and the harshphysical environment. Specifically, it apparently lackspheromones and is flightless, with highly reduced wingsand strongly developed hind legs for jumping (Crafford1990). Caterpillars of P. marioni are the major litter-dwelling detritivores on the Prince Edwards and play anessential role in nutrient cycling (Smith and Steenkamp1992a) where they annually process *1,500 tons of deadplant material (Crafford et al. 1986; Crafford 1990). Cat-erpillars also stimulate the mineralization of nutrients fromplant litter in lowland plant communities (Smith 1985;Smith and Steenkamp 1992b; Smith and Steenkamp 1993).On Marion Island they are under considerable threatbecause they form the preferred prey of invasive housemice, which are absent from the neighbouring PrinceEdward Island (Crafford 1990; Chown and Smith 1993).Establishing the extent of population differences in thisspecies between the two islands is therefore essential forinforming management actions, which include plans formouse eradication on Marion Island (Davies et al. 2007;Wanless et al. 2010).To do so, and to investigate various other components ofpopulation variation in P. marioni, species-specific micro-satellite markers were developed. Caterpillars were col-lected at Swartkop Point on Marion Island withinWandering Albatross nests. Genomic DNA was extractedfrom 44 individuals (caterpillars) with the Qiagen DNeasyBlood and Tissue Kit. An enriched microsatellite librarywas constructed in association with Inqaba BiotechnicalIndustries (Pty) Ltd (http://www.inqababiotec.co.za) bymeans of the FIASCO method (Zane et al. 2002). Thelibrary was constructed using the protocol from Zhang et al.(2008) with two oligonucleotides (50-GACGATGAGTCCTGAG-30 and 50-TACTCAGGACTCAT-30) as adaptersand the adapter-specific primer MseI-N (50-GATGAGTCCTGAGTAAN-30). Genomic DNA was enriched using(AC)12, (TA)12 and (CT)12 di-nucleotide repeat probes.C. W. Groenewald  C. Born  B. Jansen van Vuuren (&)Evolutionary Genomics Group, Department of Botanyand Zoology, Stellenbosch University, Private Bag X1,Matieland, Stellenbosch 7602, South Africae-mail: bjvv@sun.ac.zaC. W. Groenewald  S. L. Chown  B. Jansen van VuurenCentre for Invasion Biology, Department of Botanyand Zoology, Stellenbosch University, Private Bag X1,Matieland, Stellenbosch 7602, South Africa123Conservation Genet Resour (2011) 3:291–294DOI 10.1007/s12686-010-9344-9Table1Theprimersequences,repeatmotif,GenBankaccessionnumbersandbasicstatisticsofthemicrosatellitelocidevelopedforPringleophagamarioniLocusnamePrimersequences(50 –30 )DyeGenBankaccessionnumberRepeatmotifSizerangeNNaHOHEPm01F:CGTGAGGACCAGTTTCTTCC6-FAMHM035496(TG) 4CG(TG) 6CT(TG) 5340–3864470.2670.360R:ACGGTTAGTGTTGGCACCATPm04F:AGTCGCCAGTGACAAGTGTGNEDHM035497(CA) 10331–3394330.3020.367R:CCTCGCAGTGCGTCATAGTPm05F:AGCTGGCTTCATTGATACCG6-FAMHM035498(CA) 6TA(CA) 8263–2654320.2560.260R:TCAAAGTGCCACCGCTAAGTPm06F:GATGACGTGATGTGATGGCTAPETHM035499(TG) 9AG(TG) 12270–2804440.2950.647R:GAGATCACCAAATCCCACGA*Pm07F:CATACGTCGAAGGCCACTTTVICHM035500(TG) 7246441n/an/aR:AAGTTCCCAATCCACACTGG*Pm08F:TGTGTCTAGCAACTGCCAAAANEDHM035501(TG) 6GG(TG) 7244431n/an/aR:ATGAGCCGCAAGAGTAGAGGPm14F:TTCCTGTAGCACCAACTATTATCAGPETHM035502(TA) 685–874320.0470.046R:GCGTTATACTCACACCAGCGTTAPm15F:GCCTATGGGTGCTCCTTTCVICHM035503(CT) 4CW(CT) 974–864450.1670.407R:AGATACAGAGGCACGAAGACAGTPm16F:GCTTGCGTGCGTGTGTAANEDHM035504(TG) 1260–704430.5000.549R:GCCTCTTACTCTGTTTCCATCCPm20F:CGATATGTGTTTGCGTACGTGVICHM035505(TG) 11379–4014450.5680.568R:AGCTGGTGTAATGATGATGGTGPm23F:CCCAACCTCTGCACTAGACGVICHM035506(TG) 8AG(TG) 10244–2784450.7270.753R:GTTGTTCCAACTTTCTGCCTTA*Pm26F:GTGAGGAAATCCCGCACTTPETHM035507(TG) 7160441n/an/aR:GGGTGGCCAGAGACATACACPm30F:TACAGTTCGTGTGCGTGTGT6-FAMHM035508(TG) 6CG(TG) 781–874430.2950.320R:AGCCGCAAGAGTAGAGGCTAPm31F:GCAAAGCATGATAGCAAATAGGNEDHM035509(TG) 13250–2774440.5680.577R:CATTACACACGCACAAACACTTPm35F:CGGAAGCTTGGCAAATGTATNEDHM035510(AC) 5CC(AC) 4171–1794430.0910.130R:TTGAGGATATAAGCGTGTGTGCNnumberofindividualsgenotyped,Nanumberofalleles,HOobservedheterozygosity,HEexpectedheterozygosity.Monomorphicmarkersindicatedwithasterisk292 Conservation Genet Resour (2011) 3:291–294123A total of 128 positive clones were sequenced of which 38contained microsatellite motifs of five or more repeatswhich also had sufficient flanking regions for primer design.Primers were designed for these clones using Primer 3 Plus(Untergasser et al. 2007) and ordered from Applied Bio-systems with a fluorescent dye (6-FAM, PET, VIC or NED)associated with the forward primers. Primers were tested foramplification and polymorphism. Sequences of the clones(Pm01–Pm35) were deposited in GenBank (accessionnumbers HM035496-HM035510). The QIAGEN MultiplexPCR Kit was used to amplify markers in a single PCRreaction following a protocol which included Q-solution(QIAGEN). Multiplex reactions (numbered 1–3) consistedof the following primer pairs: 1) Pm01, Pm05, Pm23,Pm30; 2) Pm04, Pm06, Pm14, Pm16 and 3) Pm15, Pm20,Pm31, Pm35. Amplifications were performed (GeneAmp2700 Thermocycler; Applied Biosystems) in a final volumeof 10 ll containing 2 ll (±80 ng) of DNA, 5 ll of 2XQIAGEN Multiplex PCR Master Mix, 1 ll of Q-solution(5X), 1 ll of primer mix (2 lM) and 1 ll of ddH2O.Amplifications comprised an initial denaturation at 95C for15 min, 30 cycles at 94C for 30 s, 60C for 90 s and 72Cfor 50 s. A final elongation step at 60C for 30 min com-pleted reactions. Genotyping was performed in an ABI 3730automatic sequencer (Applied Biosystems) using 0.2 ll ofGS500LIZ size standard (Applied Biosystems). Alleleswere scored using GeneMapper 3.7 (Applied Biosystems).Following the initial screening process, fifteen micro-satellite markers were selected for further use given theirsuccessful amplification and ease of inclusion into a PCRmultiplex. These primer sequences, repeat motifs andGenBank accession numbers are given in Table 1. Of these,12 markers were polymorphic in our study population. Thethree monomorphic markers (Pm07, Pm08 and Pm26) arealso listed, but excluded from subsequent analyses. Table 1also includes summary statistics for the markers. Thenumber of alleles per locus varied between 2 and 7 (averageof 3.83 alleles per locus). GENEPOP 4.0.10 was used toperform Hardy–Weinberg equilibrium and linkage dis-equilibrium tests as well as to calculate the observed andexpected heterozygosities. The population was in Hardy–Weinberg equilibrium for all the markers except for Pm06(P-value = 0) and Pm15 (P-value = 0.0003). This devia-tion was attributed to the occurrence of null alleles as evi-denced by an excess of homozygotes at a frequency of0.2451 and 0.2524 respectively (MICROCHECKER; vanOosterhout et al. 2004; see also Okello et al. 2005). Lepi-doptera species are notorious for the occurrence of nullalleles (Chapuis and Estoup 2007; Meglecz et al. 2004).Even though two of the microsatellite markers showed signsof null alleles in the study population, it might still be usefulin other Pringleophaga populations, and the occurrence ofnull alleles would have to be tested on a case-by-case basis.No significant linkage disequilibrium could be detectedafter Bonferroni corrections (P-value adjusted to 0.0012).The markers can therefore be considered as independent.Observed (HO) and expected heterozygosities (HE) werecalculated according to Raymond and Rousset (1995) andWeir and Cockerham (1984). Observed and expected het-erozygosities ranged from 0.047 to 0.727 and 0.046 to0.753, respectively (Table 1). These markers will be usefulin studies that hold implications for the management andconservation of this unique species on the Prince EdwardIslands.Acknowledgments The work was supported by a NRF/SANAPgrant to BvV (Gun 206954). The Central Analytical Facility at Stel-lenbosch University is acknowledged for genotyping work.ReferencesChapuis M-P, Estoup A (2007) Microsatellite null alleles andestimation of population differentiation. Mol Biol Evol24:621–631Chown SL, Smith VR (1993) Climate change and the short-termimpact of feral house mice at the sub-Antarctic Prince EdwardIslands. Oecologia 96:508–516Crafford JE (1990) The role of feral house mice in ecosystemfunctioning on Marion Island. In: Kerry KR, Hempel G (eds)Antarctic ecosystems: ecological change and conservation.Springer, Berlin, pp 359–364Crafford JE, Scholtz CH, Chown SL (1986) The insects of sub-Antarctic Marion and Prince Edward Islands, with a bibliogra-phy of entomology of the Kerguelen Biogeographical Province.S Afr J Antarct Res 16:41–84Davies SJ, Chown SL, Joubert LJ (2007) Renewed managementsystem and provisions for South Africa’s sub-Antarctic islands.Pap Proc R Soc Tasm 141:115–120Meglecz E, Petenian F, Danchin E, Coeur D’ Acier A, Rasplus J-Y,Faure E (2004) High similarity between flanking regions ofdifferent microsatellites detected within each of two species ofLepidoptera: Parnassius apollo and Euphydryas aurinia. MolEcol 13:1693–1700Okello JBA, Wittemyer G, Rasmussen HB, Douglas-Hamilton I,Nyakaana S, Arctander P, Siegismund HR (2005) Noninvasivegenotyping and Mendelian analysis of microsatellites in Africansavannah elephants. J Hered 96:679–687Raymond M, Rousset F (1995) Genepop version 1.2: a populationgenetics software for exact tests and ecumenicism. J Hered86:248–249Smith VR (1985) Seasonal dynamics of standing crop and chemicalcomposition in Marion Island (sub-Antarctic) vegetation, PhDthesis, University of the Orange Free StateSmith VR, Steenkamp M (1992a) Macroinvertebrates and litternutrient release on a sub-Antarctic island. S Afr J Bot 58:105–116Smith VR, Steenkamp M (1992b) Soil nitrogen transformations on asub-Antarctic island. Antarct Sci 4:41–50Smith VR, Steenkamp M (1993) Macroinvertebrates and peat nutrientmineralization on a sub-Antarctic island. S Afr J Bot 59:106–108Untergasser A, Nijveen H, Rao X, Bisseling T, Geurts R, LeunissenJAM (2007) Primer3Plus, an enhanced web interface to Primer3.Nucleic Acids Res 35:W71–W74Van Oosterhout C, Hutchinson WF, Wills DPM, Shipley P (2004)MICRO-CHECKER: software for identifying and correctingConservation Genet Resour (2011) 3:291–294 293123genotyping errors in microsatellite data. Mol Ecol Notes4:535–538Wanless RM, Cooper J, Slabber MJ, Ryan PG (2010) Risk assessmentof birds foraging terrestrially at Marion and Gough Islands toprimary and secondary poisoning by rodenticides. Wildl Res37:524–530Weir BS, Cockerham CC (1984) Estimating F-Statistics for theanalysis of population structure. Evolution 38:1358–1370Zane L, Baegelloni L, Patarnello T (2002) Strategies for microsat-ellite isolation: a review. Mol Ecol 11:1–16Zhang Y, He J, Zhao PX, Bouton JH, Monteros MJ (2008) Genome-wide identification of microsatellites in white clover (Trifoliumrepens L.) using FIASCO and phpSSRMiner. Plant Methods4:19294 Conservation Genet Resour (2011) 3:291–294123

Development of a microsatellite library for the flightless moth Pringleophaga marioni Viette (Lepidoptera: Tineidae)

https://scholar.sun.ac.za:443/bitstream/10019.1/113207/3/Chown_JansenVanVuuren_Cons_Gen_Res_2011.pdf

Development of a microsatellite library for the flightless moth Pringleophaga marioni Viette (Lepidoptera: Tineidae)

Abstract

Similar works

Full text

Available Versions

Stellenbosch University SUNScholar Repository