In this study, nine microsatellite loci were isolated and characterized from the seven-spotted lady beetle, Coccinella septempunctata (Coleoptera: Coccinellidae). The loci were validated and characterized using 20 samples collected from five Korean localities. These results indicate that some loci were highly variable in terms of number of alleles (2 to 13), heterozygosity (0.10 to 0.40), and polymorphic information content (0.31 to 0.85). These microsatellite markers will be very valuable for population genetic studies of C. septempunctata.Key words: Seven-spotted lady beetle, Coccinella septempunctata, microsatellite Deoxyribonucleic acid (DNA)

Cho, Youngho

Kim, Iksoo

Kim, Kee Young

Kim, Ki-Hwan

Kim, Min Jee

English

AJOL - African Journals Online

African Journal of Biotechnology Vol. 11(102), pp. 16731-16736, 20 December, 2012  Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB12.2754 ISSN 1684–5315 ©2012 Academic Journals          Full Length Research Paper  Development and characterization of nine polymorphic microsatellite markers in the seven-spotted lady beetle, Coccinella septempunctata (Coleoptera: Coccinellidae)  Min Jee Kim1, Ki-Hwan Kim2, Kee Young Kim3, Youngho Cho4 and Iksoo Kim1*  1College of Agriculture and Life Sciences, Chonnam National University, Gwangju 500-757, Republic of Korea. 2Bionics, 707 Hansin IT-TOWER, 235, Guro3-dong, Guro-gu, 152-768, Seoul, Republic of Korea. 3Department of Agricultural Biology, National Academy of Agricultural Science, Suwon 441-100, Republic of Korea. 4Department of Biology, Daejeon University, Daejeon 300-716, Republic of Korea.  Accepted 26 November, 2012  In this study, nine microsatellite loci were isolated and characterized from the seven-spotted lady beetle, Coccinella septempunctata (Coleoptera: Coccinellidae). The loci were validated and characterized using 20 samples collected from five Korean localities. These results indicate that some loci were highly variable in terms of number of alleles (2 to 13), heterozygosity (0.10 to 0.40), and polymorphic information content (0.31 to 0.85). These microsatellite markers will be very valuable for population genetic studies of C. septempunctata.  Key words: Seven-spotted lady beetle, Coccinella septempunctata, microsatellite Deoxyribonucleic acid (DNA).   INTRODUCTION  The seven-spotted lady beetle, Coccinella septempunctata (Coleoptera: Coccinellidae), is one of the best known insects capable of predation. In North America, the species has repeatedly been introduced starting in the 1950s and has become a more effective predator than some native lady beetle species in some areas (Angalet et al., 1979; Schaefer et al., 1987). The species is widely-distributed across Eurasia to the Palearctic (Iablokoff-Khnzorian, 1982), including Korea. Due partly to an extensive and discontinuous distribution of the species, taxonomic status of the seven-spotted lady beetle has long been investigated (Rao, 1962) and some populations in fact, have been designated as a distinct species (Dobzhansky, 1933). Recently, Marin et al. (2010) assessed species status of the geographic populations collected throughout  the  Paleartic  region using  mitochondrial  COI gene, inter-simple sequence     *Corresponding author. E-mail: ikkim81@chonnam.ac.kr.  repeat (ISSR) marker, and a few morphological characters, along with cross breeding experiment. They found a high sequence divergence of COI gene in a population, but other experimental results consistently confirmed that all populations of the species belong to the same species (Marin et al., 2010). Nevertheless, microsatellite or other polymorphic markers were necessitated to further illustrate population genetic perspective of the species.  Previously, a large set of microsatellite markers were developed from a within-tribe species, Harmoniaaxyridis, but cross-species amplification was only successful from the within-generic species, but not from Coccinella species (Loiseauat al., 2009). Therefore, in this study, we isolated and characterized nine microsatellite markers that will be useful to address various questions raised previously regarding this species, such as dispersal (Van der Werf et al., 2000), high individual variation (Hodek and Michaud, 2008), and species complexity (Marin et al., 2010).  16732        Afr. J. Biotechnol.    MATERIALS AND METHODS  Insects  Adult C. septempunctata were caught from five Korean localities named Gangneung, Anmyeon-Island, Chungju, Jeju-Island and Yeongam from May to June 2009. Each adult was collected at least 3 m from the neighboring one, in order to prevent over-representation of siblings from each locality. The samples were frozen at -70°C until use in molecular analysis.   Enrichment for microsatellite-containing DNA fragments  A microsatellite library was developed using methods adapted from Glenn and Schable (2005). A single individual of C. septempunctata was crushed in a glass grinder in liquid nitrogen. After removing the midgut, genomic DNA was extracted using a DNA Extraction Kit, in accordance with the manufacturer’s instruction (Qiagen, Valencia, CA).The Genomic DNA was then digested with RsaI (Promega, Madison, WI), ligated to SuperSNX linkers, hybridized independently to three mixtures of biotinylated oligonucleotides, and captured on streptavidin beads. Microsatellite enriched fragments were amplified using the SuperSNX24-F primer and cloned with the TOPO TA cloning kit (Invitrogen, Carlsbad, CA). A total of 195 clones were sequenced using M13 forward and reverse primers with an ABI 3730xl genetics analyzer (Applied Biosystems, Foster City, CA). Sequences were assembled using Sequncher 4.2.2 (Gene Codes, Ann Arbor, MI). Primers for 96 candidate loci that contained the microsatellite motif were designed using the web-based program Primer 3 (Rozen and Skaletsky, 2000) to detect amplification and redundancy.    Polymerase chain reaction amplification   PCR was conducted in a 10 μL reaction volume in an ABI 2720 Thermo cycler (Applied Biosystems, Foster City, CA) under the following condition: an initial denaturation step at 95°C for 3 min, followed by 30 cycles at 94°C for 30 s, annealing at 48 to 56°C for 30 s and 72°C for 1 min, and a final extension for 5 min at 72°C. Each reaction contained 30 ng of DNA, 1× PCR buffer, 200 μM of dNTPs, 5 pmol of each primer, and 0.5 unit of FR-Taq DNA polymerase (Biomedic, Bucheon, Gyeonggi-do). The 34 pairs of primers that were designed using the OLIGO 4.0 software (National Bioscience (National Biosciences, Plymouth, MN) were labeled with the 6-carboxyfluorescein fluorescent dye.   Genotyping  To validate the applicability of the microsatellites to population genetic studies of C. septempunctata, PCR amplification was conducted for 20 samples collected from five natural populations in Korea, resulting in variability in nine pairs of primers. For size analysis, 0.2 μL of the PCR product was mixed with 9.8 μL of Hi-Di Formamide (Applied Biosystems, Foster City, CA) and 0.2 μL of a Liz-500 size standard. The samples were then denatured for 5 min at 95°C, placed on ice, and run on an ABI 3730xl sequencer (Applied Biosystems, Foster City, CA). GENEMAPPER ver. 4.0 (Applied Biosystems, Foster City, CA) was used to select the allele sizes. To determine the accuracy of size determinations, electrophoresis was conducted at least three times on two independent PCR products.   Statistical analysis  From  each  locus  observed  heterozygosity  (HO; Weir, 1996),      expected heterozygosity (HE;Nei, 1987), Polymorphic Information Content (PIC; Bostein et al., 1980), and the allelic and genotypic frequencies were calculated using PowerMarker ver. 3.25 (Liu and Muse, 2005). Allelic Polymorphism Information Contents (PIC) was calculated using the following formula: PIC = 1- ∑ (Pi)2, where Pi is the proportion of the strain carrying ith allele that was calculated for each microsatellite locus (Bostein et al., 1980). Also, deviation from Hardy-Weinberg equilibrium (HWE) was calculated using the PowerMarker program (Liu and Muse, 2005).    RESULTS AND DISCUSSION  Of the 34 loci isolated from C. septempunctata, nine pairs of primers successfully provided products (Figure 1). The nine loci selected revealed substantial allelic diversity, varying from 2 to 13 (Table 1). In particular, the locus CSBm4_25, which contains a tetra-nucleotide repeat motif provided the highest allele number, 13. The polymorphic information contents (PIC), which is an estimation of the probability that an individual is informative with regard to the segregation of its inherited alleles, had a value of 0.31 to 0.85 with an average of 0.55 (Table 1). The locus CSBm4_25, which provided the highest allele number of 13, had the highest recorded value of 0.85, and the loci CSBm2_3, CSBm2_5, CSBm2_9, CSBm4_20, and CSBm4_57 had PIC values higher than 0.50, thereby indicating a high individual discrimination power. HO and HE at each locus ranged from 0.10 to 0.40 and 0.34 to 0.87, respectively, showing a lower HO than HE in all loci and a significant deviation from HWE was detected in eight loci following the Bonferroni correction (Table 1). Weir and Cockerham (1984) identified several biological factors, such as the Wahlund effects, inbreeding, and assertive mating that caused deficiency in heterozygotes, resulting in a deviation from HWE. Considering our microsatellite loci were genotyped only for four individuals collected from five localities in Korea, the exact reason for the lower HO may be answered after the sample size and geographic regions covered are increased. Previous study on another ladybird, Harmonia axyridis (Coleoptera: Coccinellidae), also reported a lower HO than HE in 12 among 16 loci developed (Loiseau et al., 2009). Null alleles were detected at eight loci when calculated using Micro-Checker 2.2.3 (Van Oosterhout et al., 2004). The null allele is any allele at a microsatellite locus, which consistently fails to amplify the complete product or generates a reduced one (Kwok et al., 1990). The major cause for the null allele is the mutation, which is located within the DNA sequence complementary to the oligo-primers, preventing their binding during PCR.  The genotype frequencies of each microsatellite marker shows the greatest frequency in the 153/153 and 156/156 homozygote in CS.Bm2_3 (0.35), 134/134 homozygote in CS.Bm2_5 (0.40), 239/239 homozygote in CS.Bm2_9 (0.35), 239/239 homozygote in CS.Bm3-37 (0.40), 144/144 homozygote in CS.Bm4_14 (0.60), 330/330 homozygote in CS.Bm4_20 (0.40), 235/235 and 239/239  Kim et al.         16733       Figure 1. Exemplified electrograms of nine microsatellite markers used in this study. A, the locus CSBm2_3; B, the locusCSBm2_5; C, the locusCSBm2_9; D, the locusCSBm3_37; E, the locusCSBm4_14; F, the locusCSBm4_20; G, the locusCSBm4_25; H, the locusCSBm4_57; and I, the locusCSBm4_5.X-axis, DNA size; and y-axis, peak signal height. 16734        Afr. J. Biotechnol.    Table 1. Primer sequences and characteristics of the 9 microsatellite loci in Coccinella septempunctata.  Locus Repeat motif Primer sequence (5'-3') Size range (bp) n a HO HE PIC HWE† (p-value) Estimated null allele frequency GenBank Accession no. CSBm2_3 (CTG)4 (AAG)7... (GAT)5...(GAT)3 F: FAM-TGTTGCAACTACGGCTACCA 150-156 20 3 0.25 0.60 0.52 0.001** 0.2724 JX413377 R: GTTTCAAAGTCGCTTTCACCATCA             CSBm2_5 (CAT)6...(CAG)3 F: FAM-TGCAGGAAATTAACGAGGATG 128-140 20 5 0.40 0.61 0.56 0.052 - JX413378 R: GTTTCTTCTCAAAGCCACCAATCC             CSBm2_9 (TCA)4C(CAT)5 F: FAM-TCAGCAACAACCTGTTCACC 230-242 20 7 0.25 0.73 0.69 0** 0.3151 JX413379 R: GTTTCCATTCTCGAATCCATTTCA             CSBm3_37 (ATC)5 F: FAM-TTGAAAAGGGTTCACGTTCC 239-242 20 2 0.25 0.50 0.37 0.026* 0.2241 JX413380 R: GTTTCGGTCAATAGCAGATGCAG             CSBm4_14 (TATG)7 F: FAM-GATTTGCGATTGTGAGCGTA 138-157 20 3 0.15 0.47 0.39 0.001** 0.2853 JX413381 R: GTTTGCAGCAAAATTCCCTTGAAA             CSBm4_20 (ATAC)5 F: FAM-TAAACACGGCTGCAGTTGAC 320-336 20 3 0.15 0.63 0.55 0** 0.3761 JX413382 R: GTTTCTCACGCATCGCTTGTAA             CSBm4_25 (TATC)23 F: FAM-GGGAGTTTGGCCCTCTAGTT 235-291 20 13 0.26 0.87 0.85 0** 0.3392 JX413383 R: GTTTGCCCCACTATGGGTATCTCC             CSBm4_57 (TATG)5 F: FAM-GGATCGAAACTCCAATCTGC 199-222 20 5 0.25 0.71 0.67 0** 0.3027 JX413384 R: GTTTCACCTGTGCATACGCATAAT             CSBm4_5 (CATA)6 F: FAM- CAATTTCATTCGTATCTCATCC 243-247 20 3 0.10 0.34 0.31 0.004* 0.2579 JX413385 R: GTTTCAACAACATAAGAACCGCACA  n, number of tested individuals; a, number of observed alleles; HO,observed heterozygosity; HE, expected heterozygosity; PIC, polymorphic information contents; † significant deviation from Hardy-Weinberg equilibrium (*p < 0.05, ** p < 0.01).    homozygotes in CS.Bm4_25 (0.16), 222/222 homozygote in CS.Bm4_57 (0.35), and 243/243 homozygote in CS.Bm4_5 (0.75), indicating an excess of homozygosity in many loci (Table 2). In addition, the availability, which is defined as 1 - Obs/n, where Obs is the number of  observationsKim et al.         16735    Table 2. Genotype frequencies for each microsatellite marker.  Marker Allele1 Allele2 Count Frequencya Availabiltyb CS.Bm2_3 150 150 1 0.05 1.00 150 153 1 0.05 150 156 2 0.10 153 153 7 0.35 153 156 2 0.10 156 156 7 0.35      1.00 CS.Bm2_5 128 128 1 0.05 128 134 1 0.05 131 131 2 0.10 131 134 4 0.20 131 137 1 0.05 134 134 8 0.40 134 137 1 0.05 134 140 1 0.05 140 140 1 0.05      1.00 CS.Bm2_9 230 230 1 0.05 230 239 2 0.10 233 239 1 0.05 233 242 1 0.05 235 238 1 0.05 236 236 5 0.25 239 239 7 0.35 242 242 2 0.10       CS.Bm3_37 239 239 8 0.40 1.00 239 242 5 0.25 242 242 7 0.35       CS.Bm4_14  138 138 5 0.25 1.00 138 144 1 0.05 144 144 12 0.60 144 157 2 0.10       CS.Bm4_20 320 320 5 0.25 1.00 320 330 3 0.15 330 330 8 0.40 336 336 4 0.20       CS.Bm4_25 231 235 1 0.05 0.95 235 235 3 0.16 235 239 1 0.05 235 288 1 0.05 239 239 3 0.16 242 242 1 0.05 243 243 1 0.05 245 245 1 0.05 247 247 1 0.05 251 263 1 0.05 251 291 1 0.05 16736        Afr. J. Biotechnol.    Table 2. Continued.   259 259 1 0.05  275 275 1 0.05 288 288 2 0.11       CS.Bm4_57 199 199 1 0.05 1.00 199 205 1 0.05 199 222 1 0.05 205 205 2 0.10 210 210 4 0.20 210 222 1 0.05 214 214 1 0.05 214 222 2 0.10 222 222 7 0.35       CS.Bm4_5 243 243 15 0.75 1.00 243 247 1 0.05 243 252 1 0.05 247 247 2 0.10  aThe sample allele frequencies are calculated as  = nu /(2n), with the variance estimated as Var( u) ( u + uv−2 ), where means "estimated by". The sample genotype frequencies uv are calculated as uv / Both the u and uv are unbiased Maximum Likelihood Estimates (MLEs) of the population frequencies. Confidence intervals for allele and genotype frequencies are formed by resampling individuals form the data set; b,Availability is defined as1−Obs/ n , where Obsis the number of observations and n is the number of individuals sampled. And the number of observation for a marker locus is defined as the number of non-missing alleles (for haploid data) or non-missing genotypes (for diploid data) observed in the sample. A genotype is regarded as missing if one of its two alleles is missing.    of given markers and n is the number of individuals sampled, was 0.95 to 1.00 with an average of 0.99 per locus, providing generally high values (Table 2). Collectively, the microsatellite markers developed in this study will be very valuable for better understanding the population and species complexity of C. septempunctata.   REFERENCES  Angalet GW, Tropp JM, Eggert AN (1979). Coccinella septempunctatain the United States: recolonizations and notes on its ecology. Environ. Entomol. 8:896-901. Dobzhansky T (1933). Geographical variation in lady-beetles. Am. Nat. 67:97-126. Glenn TC, Schable NA (2005). Isolating microsatellite DNA loci. Methods Enzymol. 395:202-222.  Hodek I, Michaud JP (2008). Why is Coccinella septempunctata so successful? (A point-of-view). Eur. J. Entomol. 105:1-12. Iablokoff-Khnzorian SM (1982). Les coccinelles, Coléoptères-Coccinellidae: Tribu coccinellini des régions paléarctique et orientale. Boubée, Paris. Kwok S, Kellog DE, McKinney N, Spasic D, Goda L, Levenson C, Sninsky JJ (1990). Effects of primer-template mismatches on the polymerase chain reaction: human immunodeficiency virus 1 model studies. Nucleic Acids Res. 18:999-1005. Liu K, Muse SV (2005). PowerMarker: integrated analysis environment for genetic marker data. Bioinformatics 21:2128-2129. Loiseau A, Malausa T, Lombaert E, Martin JF, Estoup A (2009). Isolation and characterization of microsatellites in the harlequin ladybird, Harmonia axyridis (Coleoptera, Coccinellidae), and cross-species amplification within the family Coccinellidae. Mol. Ecol. Resour. 9:934-937. Marin J, Crouau-Roy B, Hemptinne JL, Lecompte E, Magro A (2010). Coccinella septempunctata (Coleoptera, Coccinellidae): a species complex? Zool. Scr. 39:591-602. Rao VS (1962). The status of Coccinella septempunctata  L. and its varieties divaricata Oliv. and confusa Wied. Can. Entomol. 94:1341-1343. Rozen S, Skaletsky HJ (2000). PRIMER3 on the WWW for general users and for biological programmers. In: Krawets S,Misener S (eds) Bioinformatics Methods and Protocols: Methods in Molecular Biology. Totowa, NJ, Humana Press. pp. 365-386.  Schaefer PW, Dysart RJ, Specht AB (1987). North American distribution of Coccinella septempunctata (Coleoptera: Coccinellidae) and its mass appearance in coastal Delaware. Environ. Entomol.16:368-373. Van der WW, Evans EW, Powell J (2000). Measuring and modelling the dispersal of Coccinella septempunctata (Coleoptera: Coccinellidae) in alfalfa fields. Eur. J. Entomol. 97:487-493.  Van Oosterhout C, Hutchinson WF, Wills DPM, Shipley P (2004). Micro-Checker: software for identifying and correcting genotyping errors in microsatellite data. Mol. Ecol. Notes 4:535-538. Weir BS, Cockerham CC (1984). Estimating F-statistics for the analysis of population structure. Evolution 38:1358-1370.      

Development and characterization of nine polymorphic microsatellite markers in the seven-spotted lady beetle, Coccinella septempunctata (Coleoptera: Coccinellidae)

https://www.ajol.info/index.php/ajb/article/download/130026/119586

Development and characterization of nine polymorphic microsatellite markers in the seven-spotted lady beetle, Coccinella septempunctata (Coleoptera: Coccinellidae)

Abstract

Similar works

Full text

Available Versions

AJOL - African Journals Online