Objective: To obtain adequate amounts of starting material to beused in molecular diagnosis. Methods: Isothermal ramificationamplification. Results: Water samples where Legionella spp wasdiluted and small amount of human DNA from HIV infected patientswere submitted to a new amplification technology (GenomiPhi®kit). Those samples that were previously negative upon PCRbecame positive after the treatment. Conclusion: The newtechnology allows for molecular assays to be performed in samplesof reduced volumes or low concentration

Fátima de Melo Azevedo

Melissa Mitne

Vanda Dolabela de Magalhães

Directory of Open Access Journals

einstein. 2004; 2(1):20-220 Azevedo FM, Mitne M, Magalhães VDThe use of a novel amplification tool for molecular diagnosis ofchallenging samplesO uso de uma nova ferramenta de amplificação para o diagnóstico molecular de amostrasdifíceis*Fátima de Melo Azevedo1, Melissa Mitne2, Vanda Dolabela de Magalhães3ORIGINAL ARTICLEABSTRACTObjective: To obtain adequate amounts of starting material to beused in molecular diagnosis. Methods: Isothermal ramificationamplification. Results: Water samples where Legionella spp wasdiluted and small amount of human DNA from HIV infected patientswere submitted to a new amplification technology (GenomiPhi®kit). Those samples that were previously negative upon PCRbecame positive after the treatment. Conclusion: The newtechnology allows for molecular assays to be performed in samplesof reduced volumes or low concentration.Keywords: Legionella/isolation & purification; Legionella/growth& development; Molecular diagnostic techniques/methods; HIVRESUMOObjetivo: Obter quantidades adequadas de material inicial paraser utilizado em diagnóstico molecular. Métodos: Amplificaçãoisotérmica e ramificada. Resultados: Amostras de água ondeLegionella spp se encontrava diluída e pequena quantidade deDNA humano extraído de paciente com infecção por HIV foramsubmetidas a uma nova tecnologia de amplificação (kitGenomiPhi®)). Essas amostras, que haviam apresentado resultadonegativo na PCR realizada anteriormente, tornaram-se positivasapós o tratamento. Conclusão: A nova tecnologia permite arealização de ensaios moleculares em amostras de volume reduzidoou baixa concentração.Descritores: Legionella/isolamento & purificação; Legionella/crescimento & desenvolvimento; Técnicas de diagnósticomolecular/métodos; HIVINTRODUCTIONA fundamental issue for molecular based diagnosis isthe detection of specific DNA sequences. Thepolymerase chain reaction (PCR) has been extensivelyused to amplify defined sequences both in clinical andresearch laboratories(1). In conventional PCR, specificprimers anneal to complementary bases at the targetmolecule and allow the action of DNA polymerases toreplicate the fragment exponentially. Nevertheless, onsome occasions, genetic material present in clinicalsamples is not available in sufficient quantity and/orquality, hindering a successful amplification. Theproperties of a DNA polymerase isolated from abacteriophage (Phi29) have been exploited to overcomethese limitations. This enzyme is capable of usinghexamer primers and supports strand displacementsynthesis. Its 3’-5’ exonuclease proofreading activityproduces higher fidelity amplified DNA when comparedto Taq DNA polymerase, the standard enzyme used inmost PCR reactions(2). This highly processive polymeraseis part of a commercial kit (GenomiPhi®, AmershamBiosciences) that allows for representativeamplification of the whole genome.In this amplification process, hexamer primersanneal to the template at multiple sites and isothermalpolymerization begins. As the reaction proceeds, thenewly complementary strand is displaced and generatesnew single-stranded DNA. This strand is then availableto new primers to bind. This type of reaction yields abranched structure. Repetitions of priming and* Study supported by FAPESP and IEP - Instituto de Ensino e Pesquisa Albert Einstein.* Study sponsored by CNPq No. 522552/95-1 and by FAPESP N. 02/08460-6.1 PhD,         Experimental Research Center, Instituto de Ensino e Pesquisa Albert Einstein.2 Experimental Research Center, Instituto de Ensino e Pesquisa Albert Einstein.3 PhD,         Experimental Research Center, Instituto de Ensino e Pesquisa Albert Einstein.Corresponding author: Vanda Dolabela de Magalhães - Instituto de Ensino e Pesquisa - HIAE - Av. Albert Einstein, 627/701 - Morumbi - CEP 05651-901 - São Paulo (SP), Brazil. Tel.: (5511) 3747-1343- Fax: (5511) 3747-0208 - e-mail: vanda@einstein.brReceived on January 11, 2004 – Accepted on February 14, 2004einstein. 2004; 2(1):20-221 The use of a novel amplificationdisplacement result in amplified double-stranded DNAof high molecular weight (figure 1).Here we describe the use of GenomiPhi® to amplifydiluted Legionella spp from water samples and HIVfrom limited amount of samples. A first attempt toamplify these pathogens by PCR directly from theavailable samples failed. After submitting the startingmaterial to GenomiPhi®, conventional PCR succeededin amplifying the expected fragments and identifyingor characterizing the pathogens.0.2 mM of each dNTP, and 2.5U of Taq polymerase(Amersham Biosciences). Template DNA wasdenatured at 94°C for 10 min., and a total of 35 cycleswere performed consisting of 94°C for 45 sec., 55°Cfor 45 sec. for primers annealing, and 72°C for extensionduring 2 min. After the last cycle, an extension of 10min. at 72°C was performed. One or 2µl of the firstPCR was used for the nested assay. Primers DP16(5’CCTCAAATCACTCTTTGGCAAC) and G2(5’GCATCHCCCACATCYAGTACTG) were used toamplify the protease region and primers F1(5’GTTGACTCAGATTGGTTGCAC) and F2(5’GTATGTCATTGACAGTCCAGC) were used for thereverse transcriptase region. The second round PCRfor both primers pairs did not differ significantly fromthe first round. All samples were performed induplicates.Agarose gel electrophoresis: amplification productswere visualized by UV translumination of ethidiumbromide-soaked agarose gel after electrophoresis. Gelconcentration was 2.5%, TAE 1X (40 mM Tris-acetate,pH 8.0, 1 mM EDTA) was used as buffer, and the runproceeded at 6 V/cm. The results were photographedby a Polaroid system.Sequencing: amplicons were purified by GFX PCRDNA Purification Kit (Amersham Biosciences) andquantified after agarose electrophoresis using a massladder as standard. Sequencing was performed in aMegaBace 1000 capillary system with DYEnamic ETTerminator Cycle Sequencing Kit (AmershamBiosciences) following manufacturers´recommendations. BLAST analysis was performed inthe NCBI site (http://www.ncbi.nlm.nih.gov).RESULTSPneumonia was diagnosed in a transplant patient andthe suspected etiological agent was L. pneumophila.Bronchoalveolar fluid was sent for molecular biologydiagnosis. PCR was positive and amplicon digestionwith appropriated restriction enzymes identified L.pneumophila.Since Legionella spp found in water supply has beenrelated to cases of pneumonia in immunocompromisedpatients(3), epidemiological investigation includedwater sampling from showers and sinks from differentrooms. Water reservoirs were also sampled. PCR waspositive only for the patient’s room shower. Nevertheless,the amount of amplification product was not enoughfor further analysis. The original shower sample wasused in the GenomiPhi® kit and yielded a larger amountof amplicon, allowing for restriction analysis andsequencing. Moreover, water samples collected fromFigure 1. Isothermal amplification by Phi29 DNA polymerase.METHODSGenomiPhi® amplification: One µl of the startingmaterial is added to 9µl of sample buffer (supplied inthe kit) in an Eppendorf microtube. The sample isdenatured at 95°C for 3 min. and allowed to cool onice. Nine µl of reaction buffer (supplied) and 1µl ofPhi29 DNA polymerase are added, maintaining thetube on ice. After mixing, the tube is incubated at 30°Cfor 16-18 hours. The enzyme is heat-inactivated at 65°Cfor 10 min. and the DNA is ready for other assays.PCR for Legionella spp: amplification of Legionellaspp was achieved following a described method(3). Theamplification product, a 386 bp fragment of the 16SrRNA subunit, was independently digested with tworestriction enzymes, Xho I and Hae III, resulting inspecific band patterns that could be assigned to L.pneumophila or other species.PCR for HIV: transcriptase and protease regionswere amplified in a nested-PCR format. Twenty-fiveµl of amplification reaction mix contained 1 X PCRbuffer (Amersham Biosciences), 0.5µM of each primer(K1–5’CAGAGCCAACAGCCCCACCA and K2–5’TTTCCCCACTAACTTCTGTATGTCATTGACA),einstein. 2004; 2(1):20-222 Azevedo FM, Mitne M, Magalhães VDother points (sinks and reservoir) were also submittedto GenomiPhi® system and resulted in positiveamplification of one reservoir sample (figure 2).Sequencing from PCR products confirmed the presenceof L. pneumophila both in bronchoalveolar fluid andpatient’s room shower. In the reservoir sample,sequencing revealed the presence of L. rubrilucens.As part of the Viral Genetic Diversity Network, ourlaboratory receives extracted DNA from HIV patients.We are expected to amplify reverse transcriptase andprotease regions of proviruses present in these samples.The sequencing of these regions identifies possibleresistant genotypes. Some samples systematically failedin the PCR reaction, very likely due to the presence ofinhibitory substances or to a low viral load. In thesecases, the amount of sample left after many attemptsto circumvent the problems was very small. The use ofGenomiPhi® resulted in positive amplification andsuccessful sequencing of the chosen regions of samplesthat have previously failed.Besides the use here described, isothermalramification amplification has been used to provideadequate density of DNA isolated from a few hundredcells in comparative genomic hybridization arrays(4).Scoring Single Nucleotide Polymorphism (SNP) alsoconsumes a great quantity of DNA due to the numberof SNPs in the human genome. In both approaches, alower accuracy is observed when DNA input is notadequate.CONCLUSIONGenomiPhi® is a potent tool to provide enough DNAto perform different assays of clinical and researchinterest when the starting materials have reducedquantities.ACKNOWLEDGMENTSWe would like to thank Amersham Biosciences forproviding the GenomiPhi® Kit even before it becamecommercially available.REFERENCES1. Saiki RK, Gelfand DH, Stoffel S, Scharf SJ, Higuchi R, Horn GT, et al. Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase.Science. 1988; 239(4839):487-91.2. Blanco L, Bernad A, Lazaro JM, Martin G, Garmendia C, Salas M.Highlyefficient DNA synthesis by the phage phi 29 DNA polymerase. Symmetricalmode of DNA replication. J Biol Chem. 1989; 264(15):8935-40.3. Jonas D, Rosenbaum A, Weyrich S, Bhakdi S.Enzyme-linked immunoassayfor detection of PCR-amplified DNA of legionellae in bronchoalveolar fluid. JClin Microbiol. 1995; 33(5):1247-52.4. Lage JM, Leamon JH, Pejovic T, Hamann S, Lacey M, Dillon D, et al. Wholegenome analysis of genetic alterations in small DNA samples usinghyperbranched strand displacement amplification and array-CGH. GenomeRes. 2003;13(2):294-307.Figure 2. Agarose gel electrophoresis of Legionella from water samplesbefore and after the use of GenomiPhi® Kit.1. PCR for Legionella spp from a water reservoir sample.2. PCR for Legionella spp from the same water reservoir sample in 1 after theuse of GenomiPhi®  kit.3. PCR for Legionella spp from sample of patient’s shower.4. PCR for Legionella spp from the same sample of patient’s shower after theuse of GenomiPhi®  kit.DISCUSSIONMany genetic analyses use PCR and it is not rare thatclinical samples are not available in adequate quantityto enable multiple testing. While random PCR usuallyyields relatively low molecular weight DNA, the actionof Phi29 DNA polymerase produces fragments varyingfrom 5 to 50 kb in length. The amplified material isrepresentative of the entire genome and informationis preserved, since few or no mutations are allowed bythe proofreading activity of the enzyme.1234

The use of a novel amplification tool for molecular diagnosis of challenging samples

Abstract

Similar works

Full text

Available Versions

Directory of Open Access Journals