PREMISE OF THE STUDY: Polymorphic microsatellite markers were developed to study
population structure and mating patterns of the monocarpic herb Moricandia moricandioides
(Brassicaceae).
METHODS AND RESULTS: Illumina MiSeq sequencing was used to develop a panel of 15
polymorphic microsatellite markers that were tested across 77 individuals from three
populations on the Iberian Peninsula. All markers were polymorphic in at least two studied
populations, and the number of alleles ranged from one to 11 per locus. The levels of
observed and expected heterozygosity ranged from 0.000 to 1.000 and from 0.153 to 0.865,
respectively. Nine and 11 loci were successfully amplified in the congeneric species M.
arvensis and M. foetida, respectively.
CONCLUSIONS: The 15 microsatellite markers will be useful for population genetic studies
of the genus Moricandia. These markers will serve as a useful tool for exploring population
structure and mating patterns of M. moricandioides.This work received funding from the European
Union’s Horizon 2020 (Marie Skłodowska-Curie
No. 655653),
Fundación BBVA (PR17-ECO-
0021),
and the Spanish Ministerio
de Economia y Competitividad (CGL2017-86626-
C2-
1-
P)

Benjamini

González-Megías

Gómez

Koressaar

Oosterhout

Perfectti

Rousset

Sobrino Vesperinas

Torices

Untergasser

Applications in Plant Sciences

English

Crossref

Characterization of microsatellite markers for Moricandia moricandioides

Cuenot, Yves

Gómez, José

González Megías, Adela

Pannell, John

Torices, Rubén

Repositorio Institucional Universidad de Granada

1 of 4Moricandia moricandioides (Boiss.) Heywood (Brassicaceae) is a monocarpic herb inhabiting semi- arid areas in the Iberian Peninsula (Sobrino Vesperinas, 1993). Moricandia moricandioides displays a particular floral morphology with parallel, dark pink petals (Gómez et al., 2016). Their nearly zygomorphic flowers are commonly vis-ited by a highly specialized assembly of insects, mostly composed of long- tongued bees (Gómez et al., 2016). The species has been used as a model species in several ecological studies related to the analy-sis of food webs and the interaction between aboveground and be-lowground insect species (e.g., González- Megías and Müller, 2010; González- Megías and Menéndez, 2012), as well as the study of plant reproductive ecology (e.g., Gómez, 1996).Moricandia moricandioides belongs to the small but econom-ically relevant genus Moricandia DC., with nine recognized spe-cies distributed in North Africa, the Middle East, Central Asia, and Southern Europe (Perfectti et  al., 2017). Other members of the genus are narrow endemics (e.g., M. foetida Bourg.) re-stricted to limited areas in southeastern Spain, as well as wide-spread weeds (e.g., M. arvensis (L.) DC.) that likely colonized the Iberian Peninsula and southern Italy from northwestern Africa. In addition, it has recently been observed that M. moricandioides individuals may discriminate kin, allowing them to adjust their floral display depending on the genetic configuration of their neighborhood (Torices et al., 2018), thus enabling potential coop-eration with kin. We here present and characterize microsatellite markers for M. moricandioides and two related species. The de-velopment of these markers will allow the exploration of the fine- spatial genetic structure within M. moricandioides populations, which is essential for testing hypotheses concerning kin selection and altruism in plants.METHODS AND RESULTSPlant collection and DNA purificationWe collected leaves from individuals of M. moricandioides culti-vated in a greenhouse from seeds sampled in three different nat-ural populations (Appendix 1). To test cross- species amplification, two related species were also collected (Appendix 1): M. arvensis (seeds sampled in June 2016) and M. foetida (leaves collected from a natural population in January 2017). All leaves were conserved in silica gel before DNA purification. We extracted genomic DNA using a BioSprint 96 DNA Plant Kit (QIAGEN, Hilden, Germany) following the manufacturer’s instructions and eluted in 100 μL of nuclease- free water.Applications in Plant Sciences 2018 6(8): e1172; http://www.wileyonlinelibrary.com/journal/AppsPlantSci © 2018 Cuenot et al. Applications in Plant Sciences is published by Wiley Periodicals, Inc. on behalf of the Botanical Society of America. This is an open access article under the terms of the Creative Commons Attribution License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited.Characterization of microsatellite markers for Moricandia moricandioides (Brassicaceae) and related speciesYves Cuenot1, José M. Gómez2, Adela González-Megias3 , John R. Pannell1 , and Rubén Torices1,2,4P R I M E R  N O T EManuscript received 5 July 2018; revision accepted 24 July 2018.1 Department of Ecology and Evolution, Université de Lausanne, CH-1015 Lausanne, Switzerland2 Estación Experimental de Zonas Áridas, Consejo Superior de Investigaciones Científicas, Ctra. de Sacramento s/n, La Cañada de San Urbano, E-04120 Almería, Spain3 Departamento de Zoología, Facultad de Ciencias, Universidad de Granada, 18071 Granada, Spain4 Author for correspondence: rubentorices@gmail.comCitation: Cuenot, Y., J. M. Gómez, A. González-Megias, J. R. Pannell, and R. Torices. 2018. Characterization of microsatellite markers for Moricandia moricandioides (Brassicaceae) and related species. Applications in Plant Sciences 6(8): e1172.doi:10.1002/aps3.1172PREMISE OF THE STUDY: Polymorphic microsatellite markers were developed to study population structure and mating patterns of the monocarpic herb Moricandia moricandioides (Brassicaceae).METHODS AND RESULTS: Illumina MiSeq sequencing was used to develop a panel of 15 polymorphic microsatellite markers that were tested across 77 individuals from three populations on the Iberian Peninsula. All markers were polymorphic in at least two studied populations, and the number of alleles ranged from one to 11 per locus. The levels of observed and expected heterozygosity ranged from 0.000 to 1.000 and from 0.153 to 0.865, respectively. Nine and 11 loci were successfully amplified in the congeneric species M. arvensis and M. foetida, respectively.CONCLUSIONS: The 15 microsatellite markers will be useful for population genetic studies of the genus Moricandia. These markers will serve as a useful tool for exploring population structure and mating patterns of M. moricandioides.  KEY WORDS   Brassicaceae; microsatellites; Moricandia arvensis; Moricandia foetida; Moricandia moricandioides.Applications in Plant Sciences 2018 6(8): e1172 Cuenot et al.—Moricandia moricandioides microsatellites • 2 of 4http://www.wileyonlinelibrary.com/journal/AppsPlantSci © 2018 Cuenot et al.Development of microsatellite primersMicrosatellite markers were developed using an enrichment proto-col at AllGenetics & Biology (A Coruña, Spain). The library, prepared using the Nextera XT DNA kit (Illumina, San Diego, California, USA), was enriched in the following motifs: AT, AAG, ACG, ATCT, and ACAT. The enriched library was then sequenced on an Illumina MiSeq platform (PE300). Assembly of the reads was performed in Geneious 8.1.8 (Biomatters Ltd., Auckland, New Zealand) after qual-ity checking and removal of duplicate sequences. Primers were then designed with default parameters in Primer3 (Koressaar and Remm, 2007; Untergasser et al., 2012) using sequences with at least 80 nu-cleotides, and 500 primer pairs were developed that hybridized in the microsatellite flanking regions. We first tested and checked for polymorphism in 72 primer pairs using 11 M. moricandioides sam-ples from the three populations. Of these 72 primer pairs, 15 poly-morphic microsatellite markers were selected (with three or more alleles per locus) and tested using 77 samples from the three popu-lations. The markers were organized into five multiplexes according to the primer properties and size ranges (Table 1).PCRs were performed in a final reaction volume of 12.5  μL, including 1 μL of DNA (10 ng/μL), 6.25 μL of the Type- it Microsatellite PCR kit (QIAGEN), 4 μL of PCR- grade water, and 1.25 μL of primer mix (concentration given in Appendix S1). The optimal PCR protocol consisted of an initial denaturation step at 95°C for 5 min; followed by 30 cycles of 95°C for 30 s, 57°C for 90 s, and 72°C for 30 s; eight cycles of 95°C for 30 s, 53°C for 90 s, and 72°C for 30 s; and a final extension step at 68°C for 30 min. Oligonucleotide tails were attached to the 5′ ends of the primers to allow for fluorescent labeling. The oligonucleotide tails used were the universal sequences M13 (5′- GGAAACAGCTATGACCAT- 3′), CAG (5′- CAGTCGGGCGTCATC- 3′), and T3 (5′- AATTAAC- CCTCACTAAAGGG- 3′). The three oligonucleotides were labeled with HEX, FAM, and TAMRA dyes, respectively (Macrogen, Seoul, South Korea; Table 1, Appendix S1). PCR products were analyzed on an ABI 3730xl Genetic Analyzer (Applied Biosystems, Waltham, Massachusetts, USA) with the GeneScan 400 LIZ internal size standard (Applied Biosystems). Fragment length and scoring were performed using Geneious 10.2.3 (Biomatters Ltd.).Data analysisGenetic diversity parameters, pairwise linkage disequilibrium (LD), and Hardy–Weinberg equilibrium (HWE) were calculated using GENEPOP 4.7.0 (Rousset, 2008) for each of the three populations of M. moricandioides. We adjusted both tests for multiple compar-isons using Benjamini and Hochberg’s (1995) correction for HWE and Benjamini and Yekutieli’s (2001) adjustment for the LD test, given non- independence between tests. Occurrence of null alleles was tested with MICRO- CHECKER 2.2.3 (van Oosterhout et  al., 2004).TABLE 1. Characteristics of 15 microsatellite loci developed in Moricandia moricandioides.Locusa Primer sequences (5′–3′)Repeat  motifAllele size range (bp) A MultiplexFluorescent  dyeENA accession no.Mmo031 F: GAAGACTCCAAGCCTACCGG (AAG)5 218–260 11 5 FAM LS483218R: ACGTCAGGATCACAACGCTTMmo096 F: AGTCGACATGGTTGCGCTTA (AG)5 225–241 9 2 HEX LS483220R: ACCAGTGGTTAAGGTCGCTCMmo170 F: ATCGTCGGTGACACAAGAGC (GTT)6 125–167 7 1 TAMRA LS483219R: ATGCTCGAGCCATCATCACCMmo176 F: GTGCTGAGGAGAACCCACTT (CT)7 195–207 6 1 FAM LS483221R: TTTCGCGTTTCTCTGCTCCAMmo185 F: GATGTCGAGAAGAGCGTTGC (AG)6 102–132 6 5 FAM LS483222R: GGCATATACGACGAGCACCAMmo212 F: AGATGCTCTTCCAACGCTCC (AT)5 119–131 4 3 HEX LS483223R: CAGAAGCGAAACCCTGCAAAMmo235 F: ACGCCGCCATCATAAGCTTT (CCT)6 158–170 5 4 HEX LS483224R: CGAGCAAACAATGGAGCGAGMmo262 F: AGTAACAGTGGTTGGTGCCT (CT)14 286–314 12 2 FAM LS483225R: TGGTTTAGGGTTTGGACGGGMmo319 F: TGGAGTTCTAGGTCCAGCCA (GT)6 202–228 6 4 FAM LS483226R: AGCTTCACCTTTGGTACCGAMmo335 F: AATAGGAGCGGGAGGAGCAG (AG)5 108–144 2 2 TAMRA LS483227R: AGCCACGACATTCAGGGTTTMmo393 F: GTTTGCACCTGCTTTGACGT (GCT)19 208–235 9 5 HEX LS483228R: ATATGTGCTGTGGGCGGGTAMmo402 F: AAGCCGCCACAACCTACATT (CCT)5 158–194 4 4 TAMRA LS483229R: CAGGAGGTGCTTCTACTTCCCMmo406 F: ATCAACGATGGCACCAGCA (AG)6 196–238 16 1 HEX LS483230R: ACCTTCCTTCCGGTTCCTCAMmo439 F: GTTCGTCACCGTTAAAGCACC (AG)5 204–214 6 3 TAMRA LS483231R: GACATCTTAGCCGCGTTCGAMmo465 F: GCGAGCTCTGTTCCCAGATT (CT)8 300–326 10 3 FAM LS483232R: AGCTGTCATCACCTTTGTCCGNote: A = number of alleles sampled; ENA = European Nucleotide Archive.aOptimal annealing temperature was 55°C for all loci.Applications in Plant Sciences 2018 6(8): e1172 Cuenot et al.—Moricandia moricandioides microsatellites • 3 of 4http://www.wileyonlinelibrary.com/journal/AppsPlantSci © 2018 Cuenot et al.The number of alleles per locus ranged from one to 11 (Table  2). The observed heterozygosity ranged from 0.000 to 1.000, and the expected heterozygosity ranged from 0.153 to 0.865 (Table  2). Loci 185 and 335 showed significant deviation from HWE in all three populations. Loci 335 showed two alleles fixed in heterozygosity. Loci 170, 176, 235, 393, 406, 439, and 465 showed deviation from HWE in one or two populations. Loci 170 and 393 were monomorphic in population B. Loci 031, 096, 212, 262, 319, and 402 showed no deviation from HWE. There was no significant LD between any pairs of loci. There was no evidence of null alleles for any locus in population B. Loci 170, 176, 235, and 465 showed evidence of null alleles in population A, as did loci 170 and 439 in population C. Loci 031 and 096 did not amplify consistently in all individuals of populations A and C (Table 2). The significant deviation from HWE and the presence of null alleles might be a consequence of the high genetic rela-tionship between the individuals sampled, some of which were half- siblings. All sequences, along with primers, were submitted to the European Nucleotide Archive (Table  1; http://www.ebi.ac.uk/ena/data/view/LS483218-LS483232).Cross- amplification in related speciesTests of amplification of the 15 loci were performed on two related species, M. arvensis and M. foetida (Table 3). Loci 031, 170, 185, 212, 235, 319, 393, 406, and 439 amplified in both species; loci 176, 402, and 465 amplified only in M. foetida; and loci 096, 262, and 335 did not amplify in either species. The number of alleles per locus ranged between one and five. Loci 406 and 439 were monomorphic in M. arvensis, whereas loci 185, 393, and 402 were monomorphic in M. foetida.CONCLUSIONSWe developed and successfully amplified 15 polymorphic markers in M. moricandioides and in its close relatives M. arvensis and M. foetida. These polymorphic loci will be valuable for future studies in M. moricandioides, primarily those related to fine- scale population genetic structure and patterns of mating. In addition, the successful cross- amplification in M. arvensis and M. foetida suggests that these loci may be suitable to study gene flow, population structure, and potential introgression of the widespread M. arvensis into the other more narrowly distributed species of the genus Moricandia.ACKNOWLEDGMENTSWe thank Ángel Luis Caravantes Martínez and Neus Marí- Mena for technical assistance. This work received funding from the European Union’s Horizon 2020 (Marie Skłodowska- Curie No. 655653), Fundación BBVA (PR17- ECO- 0021), and the Spanish Ministerio de Economia y Competitividad (CGL2017- 86626- C2- 1- P).TABLE 2. Results of genetic diversity testing of the 15 microsatellites in the three populations of Moricandia moricandioides.aLocusPopulation A (n = 26) Population B (n = 25) Population C (n = 26)N A Ho He HWE N A Ho He HWE N A Ho He HWEMmo031 17 5 0.824 0.740 0.315 24 2 0.375 0.311 0.688 8 5 1.000 0.750 0.302Mmo096 16 4 0.813 0.651 0.834 20 5 0.150 0.192 0.385 19 6 0.632 0.624 0.302Mmo170 26 6 0.192 0.753 0.000† 25 1 0.000 0.000 25 6 0.280 0.730 0.000†Mmo176 25 5 0.520 0.727 0.040† 25 2 0.360 0.458 0.514 25 5 0.520 0.544 1.000Mmo185 25 4 1.000 0.664 0.000 25 3 1.000 0.579 0.000 26 6 1.000 0.670 0.000Mmo212 21 4 0.571 0.654 0.335 23 3 0.522 0.677 0.385 21 3 0.524 0.512 1.000Mmo235 25 4 0.280 0.460 0.036† 25 3 0.480 0.652 0.432 26 3 0.615 0.516 0.867Mmo262 24 7 0.750 0.706 0.699 23 5 0.348 0.464 0.419 25 7 0.640 0.751 0.788Mmo319 22 3 0.318 0.403 0.335 20 3 0.350 0.522 0.385 22 5 0.545 0.590 0.302Mmo335 25 2 1.000 0.510 0.000 25 2 1.000 0.511 0.000 25 2 1.000 0.510 0.000Mmo393 24 8 0.833 0.826 0.401 24 1 0.000 0.000 26 6 0.692 0.774 0.006Mmo402 25 3 0.520 0.458 0.834 25 2 0.280 0.393 0.432 25 3 0.160 0.153 1.000Mmo406 24 11 0.833 0.847 0.243 22 5 0.818 0.629 0.025 21 11 0.857 0.865 0.900Mmo439 24 4 0.250 0.299 0.137 25 2 0.360 0.507 0.422 22 4 0.182 0.594 0.000†Mmo465 24 8 0.458 0.681 0.036† 24 3 0.417 0.393 1.000 24 6 0.792 0.781 0.113Note: A = number of alleles; He = expected heterozygosity; Ho = observed heterozygosity; HWE = P value testing significant deviation from Hardy–Weinberg equilibrium after correction following Benjamini and Hochberg (1995); n = number of samples tested; N = number of samples with successful amplifications.aVoucher and locality information are provided in Appendix 1.†Presence of null alleles.TABLE 3. Amplification tests of microsatellites developed for Moricandia moricandioides in M. arvensis and M. foetida.LocusM. arvensis (N = 9) M. foetida (N = 9)Amplification successaAllele size  range (bp)Amplification  successaAllele size  range (bp)Mmo031 + (3) 233–254 + (2) 233–236Mmo096 — — — —Mmo170 + (4) 146–155 + (3) 167–173Mmo176 — — + (3) 201–211Mmo185 + (2) 106–112 + (1) 116Mmo212 + (2) 129–135 + (3) 131–133Mmo235 + (2) 179–194 + (5) 158–179Mmo262 — — — —Mmo319 + (2) 212–214 + (2) 200–208Mmo335 — — — —Mmo393 + (3) 214–220 + (1) 220Mmo402 — — + (1) 164Mmo406 + (1) 212 + (2) 208–210Mmo439 + (1) 208 + (2) 208–210Mmo465 — — + (3) 314–318Note: + = successful amplification; — = unsuccessful amplification; N = number of samples tested.aValues in parentheses represent the number of alleles.Applications in Plant Sciences 2018 6(8): e1172 Cuenot et al.—Moricandia moricandioides microsatellites • 4 of 4http://www.wileyonlinelibrary.com/journal/AppsPlantSci © 2018 Cuenot et al.DATA ACCESSIBILITYAll primer sequences and primers were submitted to the European Nucleotide Archive (accession numbers LS483218–LS483232; Table 1; http://www.ebi.ac.uk/ena/data/view/LS483218-LS483232).SUPPORTING INFORMATIONAdditional Supporting Information may be found online in the supporting information tab for this article.APPENDIX S1. Primer mix setup for multiplex reactions and final PCR concentration.LITERATURE CITEDBenjamini, Y., and M. Hochberg. 1995. Controlling the false discovery rate—A practical and powerful approach to multiple testing. Journal of the Royal Statistical Society, Series B. Methodological 57: 289–300.Benjamini, Y., and D. Yekutieli. 2001. The control of the false discovery rate in multiple testing under dependency. Annals of Statistics 29(4): 1165–1188.Gómez, J. M. 1996. Predispersal reproductive ecology of an arid land crucifer, Moricandia moricandioides: Effect of mammal herbivory on seed produc-tion. Journal of Arid Environments 33: 425–437.Gómez, J. M., R. Torices, J. Lorite, C. P. Klingenberg, and F. Perfectti. 2016. The role of pollinators in the evolution of corolla shape variation, disparity and integration in a highly diversified plant family with a conserved floral bauplan. Annals of Botany 117: 889–904.González-Megías, A., and R. Menéndez. 2012. Climate change effects on above- and below- ground interactions in a dryland ecosystem. Philosophical Transactions of the Royal Society B: Biological Sciences 367: 3115–3124.González-Megías, A., and C. Müller. 2010. Root herbivores and detritivores shape above- ground multitrophic assemblage through plant- mediated ef-fects. Journal of Animal Ecology 79: 923–931.Koressaar, T., and M. Remm. 2007. Enhancements and modifications of primer design program Primer3. Bioinformatics 23(10): 1289–1291.Perfectti, F., J. M. Gómez, A. González-Megías, M. Abdelaziz, and J. Lorite. 2017. Molecular phylogeny and evolutionary history of Moricandia DC. (Brassicaceae). PeerJ 5: e3964.Rousset, F. 2008. GENEPOP’007: A complex re- implementation of the GENEPOP software for Windows and Linux. Molecular Ecology Resources 8: 103–106.Sobrino Vesperinas, E. 1993. Moricandia DC. In S. Castroviejo [ed.], Flora Iberica, 337–344. CSIC, Madrid, Spain.Torices, R., J. M. Gómez, and J. R. Pannell. 2018. Kin discrimination al-lows plants to modify investment towards pollinator attraction. Nature Communications 9: 2018.Untergasser, A., I. Cutcutache, T. Koressaar, J. Ye, B. C. Faircloth, M. Remm, and S. G. Rozen. 2012. Primer3—New capabilities and interfaces. Nucleic Acids Research 40: e115.van Oosterhout, C., W. F. Hutchinson, D. P. M. Wills, and P. Shipley. 2004. MICRO- CHECKER: Software for identifying and correcting genotyping er-rors in microsatellite data. Molecular Ecology Notes 4: 535–538.APPENDIX 1. Voucher and locality information for Moricandia species used in this study.SpeciesPopulation IDVoucher specimen accession no.a Collection localityb Geographic coordinates NMoricandia moricandioides (Boiss.) Heywood A GDA62640 La Malahá, Granada 37°07′11.8″N, 3°43′47.2″W 26M. moricandioides B — Lanjarón, Granada 36°55′28.7″N, 3°31′52.1″W 25M. moricandioides C GDA62596 Barranco del Espartal, Baza, Granada 37°31.2′N, 2°42.2′W 26M. arvensis (L.) DC. — GDA62592 Barranco del Espartal, Baza, Granada 37°31.2′N, 2°42.2′W 9M. foetida Bourg. — GDA49837- 1 Tabernas, Almería 36°58′42.2″N, 2°27′38.0″W 9Note: N = number of sampled individuals.aVouchers are deposited at the Herbarium of the Universidad de Granada (GDA), Granada, Spain.bLocality and Spanish province.

Characterization of microsatellite markers for Moricandia moricandioides (Brassicaceae) and related species

Polymorphic microsatellite markers were developed to study population structure and mating patterns of the monocarpic herb  &lt;i&gt;Moricandia moricandioides&lt;/i&gt;  (Brassicaceae).
Illumina MiSeq sequencing was used to develop a panel of 15 polymorphic microsatellite markers that were tested across 77 individuals from three populations on the Iberian Peninsula. All markers were polymorphic in at least two studied populations, and the number of alleles ranged from one to 11 per locus. The levels of observed and expected heterozygosity ranged from 0.000 to 1.000 and from 0.153 to 0.865, respectively. Nine and 11 loci were successfully amplified in the congeneric species  &lt;i&gt;M. arvensis&lt;/i&gt;  and  &lt;i&gt;M. foetida&lt;/i&gt; , respectively.
The 15 microsatellite markers will be useful for population genetic studies of the genus  &lt;i&gt;Moricandia&lt;/i&gt; . These markers will serve as a useful tool for exploring population structure and mating patterns of  &lt;i&gt;M. moricandioides&lt;/i&gt; 

Cuenot, Y.

Gómez, J.M.

González-Megias, A.

Pannell, J.R.

Torices, R.

Serveur académique lausannois

Characterization of microsatellite markers for <i>Moricandia moricandioides</i> (Brassicaceae) and related species.

https://serval.unil.ch/resource/serval:BIB_0F6136536DCE.P001/REF.pdf

Characterization of microsatellite markers for Moricandia moricandioides (Brassicaceae) and related species

Abstract

Similar works

Full text

Available Versions

Crossref

Repositorio Institucional Universidad de Granada

Serveur académique lausannois