We found that one strain of dengue virus (Trinidad 1751; TR) did not respond to the PCR primer for Jamaica/83. We investigated such property with other 10 strains of dengue virus type 2 and found 2 more unresponsive strains. All 3 strains were isolated from the central America. To detect the envelope gene of those 3 strains by PCR, we synthesized primers based on TR strain as the reference sequence. Using these primers, we could detect the 3 strains by PCR at the usual annealing temperature. We recommed the new primer for diagnosis of DEN 2

Arai Yohko

Hirota Noriko

Kameoka Yosuke

Kitano Tadahiko

Kobayashi Masami

Yamada Ken-Ichiro

Yamamoto Kiichi

Nagasaki University's Academic Output SITE: NAOSITE

Trop. Med., 37 (2), 65-72, June, 1995 65Dengue virus type 2 unresponsive to the current PCR primer;construction of a new PCR primer to detect all strains ofDengue virus type 2.Yosuke KAMEOKA, Noriko HIROTA*, Masami KOBAYASHI*, Yohko ARAI*,Tadahiko KITANO*, Ken-ichiro YAMADA*and Kiichi YAMAMOTO*Division of Genetic Resources and "Department of Virology I,National Institute of Health, Japan.23-1 Toyama1-chome, Shinjuku-ku, Tokyo 162, JapanAbstract: Wefound that one strain of dengue virus (Trinidad 1751; TR) did not respondto the PCR primer for Jamaica/83. We investigated such property with other 10 strains ofdengue virus type 2 and found 2 more unresponsive strains. All 3 strains were isolated fromthe central America. To detect the envelope gene of those 3 strains by PCR, we synthesiz-ed primers based on TR strain as the reference sequence. Using these primers, we coulddetect the 3 strains by PCR at the usual annealing temperature. We recommedthe newprimer for diagnosis of DEN 2.Key words: PCR unresponsiveness, Dengue virus 2, Primer construction, RNA sequencing,INTR ODUCTI ONDengue fever is the most important vector-borne viral disease of man, occurring intropical latitudes where large epidemics occur involving up to several million people (Instituteof Medicine, 1986). At present, there are no prophylactic and therapeutic strategies withwhich to combat dengue virus infection and the frequency of epidemics has not decreased.Rather, the number of patients has increased over the last 10 or so years in South-East Asia(Halstead, 1992), Africa (Halstead, 1993) and central America (Gubler and Trent 1994).The disease is not native to Japan, but it is occasionally imported by travellers whohad visited tropical countries and became infected with the virus. Patient sera are occasional-ly brought to our institute for diagnosis. The hemagglutination-inhibition (HI) test has beenused for this purpose (Clarke and Casals, 1958) but PCR has recently been applied as a spee-dy diagnostic method (Deubel et al, 1990; Eldadah et at., 1991; Henchal et al, 1991; Lanciot-ti et al, 1992; Morita et al, 1991). Recently we found that a strain of dengue virus type 2(DEN 2) was non-reactive to the current PCR primer based on the sequence of Jamaica/83.In this study, we reevaluated this primer using several strains of DEN 2, and then con-structed a new primer with which we could detect this viral gene in question.Received for Publication, April 27, 199566MATERIALS AND METHODSVirus: Eleven strains of DEN 2 were studied. Trinidad/1751 (TR), Thai (Th-CMP682)and Thai (Th-CMP982) were passaged in our laboratory through mouse brain. These viruseswere passaged once in mosquito cell, C6/36 before use. New Guinea-C (NG-C), Thai (Th-NHP1193); Thai (Th-NH5293) and Vietnam (VNHH30591) were kindly supplied by Drs. A.Igarashi and K. Morita at the Institute of Tropical Medicine of Nagasaki University. Theseviruses had been passaged in C6/36. Jamaica/1983, Mexico/1983, Puerto Rico/1986 and Hon-duras/1984 strains grown in C6/36 were kindly supplied by Drs. D. Gubler and N. Karabatsosof the CDC. Dengue virus, DEN1 (Hawaii), DEN 3 (H87) and DEN 4 (H241) passaged inmouse brain were further passaged in C6/36 before use.Synthesis of the PCR primer: Primers were synthesized with reference to thenucleotide sequence of the Jamaica/83 envelope gene (Morita et al, 1991). As shown in Fig.3, positions (267-286) and (477-496) were used as sense and reverse primers, respectively.A potential primer was identified in the flanking region of these primers based upon thenucleotide sequence of TR strain. The selected positions are shown in Fig. 3.Oligonucleotide primers for both positions were constructed using betacyanoethylamideand an automated DNA synthesizer, model A391, (Applied Biosystems, California, USA) ac-cording to the manufacture's instructions. Synthesized oligomers were cleaved with am-monium hydroxide and deprotected at 55°C for 14 hr. The ammonium hydroxide wasevaporated using a vacuum-centrifuge. The oligomers were dissolved in Tris-EDTA buffer(pH 7.0) to an appropriate concentration for PCR reaction.Nucleotide sequencing: Nucleotides were sequenced by a fully automated sequencer,model 370A (Applied Biosystems, California, USA), Primers for cyclesequencing were set atthe region of 179-198 and 422-441. RT-PCR products of the region were used astemplates, then the dye-terminator cycle sequence carried out using a kit (AppliedBiosystems, California, USA) according to the supplied manual. The nucleotide sequences ofll strains were submitted to the DSDB, DDBJ, EMBL and NCBI nucleotide sequence databases, and accession numbers D45387 to D45396 and D45851.PCR Procedure: Modified RT-PCR was performed according to Morita et al (1991).Briefly, 10//1 of virus lysate in phosphate-buffered saline with 0.5% NP-40 and 10U of RNaseinhibitor (Takara Co. Kyoto, Japan) was added to 90//1 of RT-PCR cocktail [100 pmole ofeach primer, 0.2mM deoxynucleoside triphosphates, lOmM Tris, 1.5 mM MgCl2, 80 mMKC1, 10U of AMV reverse transcriptase (Life Science Inc. Florida, USA) and 2U of DNApolymerase for PCR (Toyobo Co., Osaka, Japan)], After incubating the reaction mixture for10 min at 53°C, it was amplified by PCR (92°C for 60 s, 53°C for 60 s, and 72°C for 60 s) ina thermal sequencer (Iwaki glass Co., Tokyo, Japan). The PCR product resolved by agarosegelelectrophoresis was visualized by ethidium bromide staining.RESULT67Figure 1 shows that the dengue virus type 2 (DEN 2) Trinidad 1751 (TR), did not reactwith the current primer. This was not due to the modified PCR method used in this studybecause it worked with the DEN 2 strain, prototype NG-C.To clarify whether or not the failure of PCR was specific to the TR strain, ll strainsincluding TR were tested with this primer in PCR. As shown in Fig 2, Mexico/84 and Hon-Origin2016926489267^vFig. 1. TR strain is not recognized by Jamaica/83 primer.PCR of NG-C and TR were performed as described in Materials and Methods and theproducts resolved by agarose gel-electrophoresis were stained by ethidium bromide.1. 2. 3.4. 5. 6. 7.8. 9.10.ll.12.O rigir2016926489267Fig. 2. Screening of TR like strains after PCR with Jamaica/83 primer.Eleven strains of DEN 2 were amplified by PCR using the Jamaica/83 primer. Arrows show thePCR products. Lanes were as follows:1. New Guinea-C (Prototype) 2. Vietnam (VN HH 30591) 3. Thai (Th NHP 1193)4. Thai (Th NH 5293) 5. Thai (Th CMP 982) 6. Thai (Th CMP 682)7. Puerto Rico/86 8. Jamaica/83 9. Mexico/8310. Honduras/84 ll. Trinidad 1751 12. Control (Mock)68dulus/86 strains, were not recognized by the current primer.The unresponsiveness of these strains to the primer was confirmed by the nucleotidesequence in GenBank. When the nucleotide sequence of TR was compared with that ofJamaica/83, of which the nucleotide sequence of E protein was used to synthesize the currentPCR primer, the primer sequence region of TR differed by 4 of 20 bases as shown by arrow(Fig. 3). Twenty bases of the reverse primer completely coincided with the primer sequencefrom the reference strain (Fig. 3).To expand this analysis, we determined the nucleotide sequences of ll strains at thesame 20 base-position for the sense primer. The results are summarized in Table I. It wasSense Primer Reverse PrimerING-C GTTCGTCTGCAAACACTCCA CAAGGAAATCAAAATAACACCurrent primer jam [GJTC]:TCJGWAA];ACJCCA ]:AAGGAAATCAAAATAA"CAC~|T R GTTTGTCTGCAAACATTCTA CAAGGAAATCAAAATAACAC1 . ft t t. v X 1483Core , \ ^ \ / Envelope NS1179 198\ s/Ml 441\ /___J_-Jh-l 4- H +H h '/ \267 286 / \477 496New primer TR GCATAGAGGCTAAGCTGACC TAACACCTCACTCAGGGGAANG-C GTATAGAGGCAAAGCTGACC TAACACCTCACTCAGGGGAAt tSense primer Reverse primerFig, 3, Physical map of DEN 2 and the strategy for constructing the new primer.Base sequence for the current primer was that of Jamaica/83 and that of the new primer wasbased TR. Arrows are different positions from the primer sequence. The sequence numbers ofenvelope show the range used at as primers. Sequences were derived from the Gene Bank.Table 1. Nucleotide sequences of the corresponding to the current primer inll strains of DEN 2.Virus strain Nucleotide sequence of E protein genome from 267 to 286Jamaica/83*NewGuinea-CVietnum(VN HH 30591)Thai(Th NH 5293)Thai(Th NHP 1193)Thai(Th CMP 982)Thai(Th CMP 682)Puerto Rico/86Mexico/83Hondulas/84Trinidad/1 75 1GTTCCTCTGCAAACACTCCAGTTCGTCTGCAAACACTCCAGTTCGTCTGCAAACACTCCAGTTCGTCTGCAAACACTCCAGTTCGTCTGCAAACACTCCAGTTCGTCTGCAAACACTCCAGTTCGTCTGCAAACACTCCAGTTCCTCTGCAAACACTCCAGTTTGTCTGCAAACATTCCAGTTTGTTTGCAAACATTCCAGTTTGTCTGCAAACATTCTANucleotides different from* This sequence was usedthose of Jamaica/83 are underlined,as the current primer.69confirmed again that TR differed at 4 positions from Jamaica/83. Honduras and Mexico dif-fered by 4 and 3 bases from Jamaica/83 respectively. NG-C, Vietnam and four strains fromThai differed by only one base from those of Jamaica. Puerto Rico possessed completely thesame sequence as Jamaica.In order to construct new primer, we compared the TR sequence directly with that ofNG-Cwhich was the prototype strain. Regions that were sufficiently conserved and matchedthe criteria for PCR primers were selected. These are shown in Fig. 3 as sense and reverseprimers. In the selected region for the sense primer (179-198), when the sequence of TRwas compared with that of another strain (for example NG-C), 2 bases (180 and 189) differed.To verify the new primer as a tool to identify DEN 2, the reactivity of the new primer forTR was tested against ll strains. The results are shown in Fig. 4. All strains reacted withthe new primer to generate a band of 263 bases.The specificity of the new primer was confirmed using other types of dengue virus.The primer did not anneal with the DEN-1, 3, and 4 strains (Fig. 5). Type specific PCR pro-ducts in the figure were easily recognized by their different molecular weight.1. 2. 3. 4. 5.6. 7. 8. 9.10.ll.12.Origin2016926489267'Fig. 4. Identification of ll strains of DEN 2 by PCR with the new primer.PCR and electrophoresis proceeded as described in Materials and Methods. Arrow means thePCR product of the new primer. Lanes were as follows:1. New Guinea-C (Prototype) 2. Vietnam (VN HH 30591) 3. Thai (Th NHP 1193)4. Thai (Th NH 5293) 5. Thai (Th CMP 982) 6. Thai (Th CMP 682)7. Puerto Rico/86 8. Jamaica/83 9. Mexico/8310. Honduras/84 ll. Trinidad 1751 12. Control (Mock)70邸㌔→軸軸ぶOrigin2016926489267Fig. 5. Type specificity of the new primer. Lanes were as follows:No mark: PCR with new primer*: PCR with the primer to each specific typeDISCUSSIONThe TR strain has been passaged through the mouse brain in our laboratory for a longperiod. We initially considered that the failure of TR to anneal in RT-PCR with the currentprimer was due to a mutation during brain passage. This was indicated by sequencing thePCR product. Our TR virus varied less in the sequence of PCR product, having 97%homology against the reported TR (data not shown). In the region of the sense primer, the se-quence was completely coincident with that reported (Fig. 3 and Table I). The sequence ofthe TR sense primer differed by 4 bases from that of Jamaica/83. This difference wasestimated 10°C below at melting temperature in PCR. This fact suggested that the viral genewould not anneal to the current primer under the usual PCR conditions. Mexico and Hon-duras strains differed by 3 and 4 bases respectively in the sense primer from Jamaica. Thesedifferences affected the usual annealing temperature of the PCR so that TR was notamplified by PCR. On the other hand, only one base difference in NG-C, Vietnam and fourThai strains were not effective on the performance of PCR.The characteristics that caused the PCR failure were not restricted to TR, since it wasfound in other 2 strains. Therefore, we considered that the region used for the sense primeris not always conserved in DEN 2 but is relatively variable. Hence, analysis of this regionmight support further classification of the 5 subtypes of DEN2 (Lewis et al, 1993). These 3strains of the TR-type were focused in the same geographic area of the central America, andmight have the same evolutionary origin.Dengue virus type 2 is the most well studied among the four types of DEN viruses interms of the pathology of dengue hemorrhagic fever. The disease has not been clarifiedbecause of the complicated pathology involved in the pathogenicity of the virus strain and71the host defence mechanisms including specific and nonspecific immunity. The type 2 viruscaused the highest clinical incidence of dengue shock syndrome in Thailand (Sangkhawibhaet al, 1984). We do not have any animal models of dengue virus infection. Analysis on theisolated virus and serum specimens collected from dengue patients is the only readilyavailable approach to explore the pathogenesis of dengue heamorrhagic fever. Rapid andprecise diagnosis is required to resolve this problem. The primer constructed here thatdetected all viruses tested may be useful for studies of dengue fever. We propose this primerinstead of the current primer.A CKNOWLEDGEMENTThe authors thank Drs. A. Igarashi and K. Morita in the Institute of Tropical Medicineof Nagasaki University for their technical guidance and advice.Wealso thank Drs. D. Gubler and N. Karabatsos of the CDC for their kindly providingdengue virus strains of central America.This study was partly supported by the Cooperative Research Grant 1994, (6-A-9) ofthe Institute of Tropical Medicine, Nagasaki University.REFERENCES1 ) Clarke, D.H., and Casals, J., (1958): Techniques for hemagglutination and hemagglutination-inhibi-tion with arthropod-borne viruses. Am. J. Trop. Hyg. 7, 561-573.2 ) Deubel, V., Laille, M. Hugnot, J.-P., Chungue, E., Guesdon, J.-L, Drouet, M.T., Basset, S., andChevrier, D. (1990): Identification of DEN sequences by genomic amplification: rapid diagnosis ofDEN virus serotype in peripheral blood. J. Virol. Methods 30, 41-54.3 ) Eldadah, Z.A., Asher, D.M., Godec, M.S., Pomeroy, K.L., Goldfarb, L.G., Feinstone, S.M., Levitan,H., Gibbs, CJ. Jr., and Gajdusek, C.D., (1991): Detection of flaviviruses by reverse transcriptasepolymerase chain reaction. J. Med. Virol. 33, 260-267.4 ) Gubler, D.J., and Trent, D.W., (1994): Emergence of Epidemic Dengue/Dengue Hemorrhagic Feveras a Public Health Problem in the Americas. Infectious Agents and Disease 2, 383-393.5 ) Halstead, S.B., (1992): The XXth century dengue pandemic: need for surveillance and research.Wld. Hlth. Statistics Quart. 45, 292-298.6 ) Halstead, S.B., (1993): Global Epidemiology of Dengue: Health systems in disarray. Trop. Med. 35137-146.7 ) Henchal, E.A., Polo, S.L., Vorndam, A., Yaemsiri, C., Innis, B.L., and Hoke, C.H. (1991): Sensitivi-ty and specificity of a universal primer set for the rapid diagnosis of DEN virus infections bypolymerase chain reaction and nucleic acid hybridization. Am. J. Trop. Med. Hyg. 45, 418-428.8 ) Institute of Medicine (1986): "New Vaccine development: Establishing priorities Volume ll.Diseases of Importance in Developing Countries" National Academy Press, Washington D.C.9 ) Lanciotti, R.S., Calisher, C.H., Gubler, DJ, Chang, G.J., and Vorndam, V.A., (1992): Rapid detec-tion and typing of dengue viruses from clinical samples by using reverse transcriptase-polymerasechain reaction. J.* Clin. Microbiol. 30, 545-551.7210) Lewis, J.A., Chang, G.-J., Lanciotti, R.S., Kinney, R.M., Mayer, L.W., and Trent, D.W., (1993):Phylogenetic relationships of Dengue 2 viruses. Virology 197, 216-244.ll) Morita, K., Tanaka, M.f and Igarashi, A., (1991): Rapid Identification of Dengue Virus Serotypes byUsing Polymerase Chain Reaction. J. Clin. Microbiol. 29, 2107-2110.12) Sangkhawibha, N., et al. (1984): Risk factors in dengue shock syndrome: a prospective epidemiologicstudy in Rayong Thailand, I. The 1980 outbreak. Am. J. Epidemiol. 120, 653-669.

Dengue virus type 2 unresponsive to the current PCR primer; : construction of a new PCR primer to detect all strains of Dengue virus type 2.

https://nagasaki-u.repo.nii.ac.jp/?action=repository_action_common_download&item_id=25331&item_no=1&attribute_id=18&file_no=1

Dengue virus type 2 unresponsive to the current PCR primer; : construction of a new PCR primer to detect all strains of Dengue virus type 2.

Abstract

Similar works

Full text

Available Versions

Nagasaki University's Academic Output SITE: NAOSITE