Background: Interleukin-27 is a heterodimeric cytokine belonging to IL-12 and IL-23 families, secreted  by Antigen Presenting Cells(APCs) .The IL-27 is composed of 2 subunits: Epstein-Barr virus induced gene 3 (EBI3) and p28. IL-27 is an anti-inflammatory cytokine which has an inhibitory effect on Th17 population and suppress the IL-17 expression. It is suggested that IL-27 could be a potent drug candidate for treating auto immune diseases.Methods: The IL-27 subunit genes were constructed into plasmid vectors, they sub-cloned into pETDeut-1an expression vector in restriction sites of BamHI, SacI and NotI. Subsequently the induction was done by IPTG and the recombinant proteins were confirmed by SDS-PAGE and Western Blot analysis using anti His-tag antibody.Results: The 28kDa and 25kDa protein bands were observed on SDS-PAGE and finally confirmed by Western blot technique

Bandehpour, Mojgan

Kazemi, Bahram

Koochaki, Ameneh

Massahi, Sam

Sadri, Mahrou

English

Background: Interleukin (IL)-27 is a heterodimeric cytokine belonging to IL-12 and IL-23 families, secreted by antigen presenting cells(APCs). The IL-27 is composed of 2 subunits: Epstein-Barr virus induced gene 3 (EBI3) and p28. IL-27 is an anti-inflammatory cytokine which has an inhibitory effect on Th17 population and suppress the IL-17 expression. It is suggested that IL-27 could be a potent drug candidate for treating auto immune diseases.
Materials and Methods: The EBI3 and p28 subunits of human interleukin 27 were constructed into plasmid vectors; they sub-cloned into pETDuet-1 expression vector in restriction sites of BamHI, SacI and NotI. Subsequently the induction was carried out by 1mM IPTG and the recombinant proteins were confirmed by SDS-PAGE and Western Blot analysis using anti His-tag antibody.
Results: The EBI3 and p28 subunits of human interleukin 27were cloned into plasmid vectors. The 28 and 25kDa protein bands were observed on SDS-PAGE and finally confirmed by Western blot technique.
Conclusion: In this research p28 and EBI3 proteins were produced successfully

UNL | Libraries

University of Nebraska - Lincoln
DigitalCommons@University of Nebraska - Lincoln
Nutrition and Health Sciences -- Faculty
Publications Nutrition and Health Sciences, Department of
2015
Cloning and Expression of EBI3 and p28 Subunits
of Human Interleukin 27 in E. coli
Ameneh Koochaki
Shahid Beheshti University of Medical Sciences
Mojgan Bandehpour
Shahid Beheshti University of Medical Sciences, Bandehpour@gmail.com
Sam Massahi
Shahid Beheshti University of Medical Sciences
Mahrou Sadri
University of Nebraska-Lincoln
Bahram Kazemi
Shahid Beheshti University of Medical Sciences
Follow this and additional works at: https://digitalcommons.unl.edu/nutritionfacpub
Part of the Human and Clinical Nutrition Commons, Molecular, Genetic, and Biochemical
Nutrition Commons, and the Other Nutrition Commons
This Article is brought to you for free and open access by the Nutrition and Health Sciences, Department of at DigitalCommons@University of
Nebraska - Lincoln. It has been accepted for inclusion in Nutrition and Health Sciences -- Faculty Publications by an authorized administrator of
DigitalCommons@University of Nebraska - Lincoln.
Koochaki, Ameneh; Bandehpour, Mojgan; Massahi, Sam; Sadri, Mahrou; and Kazemi, Bahram, "Cloning and Expression of EBI3 and
p28 Subunits of Human Interleukin 27 in E. coli" (2015). Nutrition and Health Sciences -- Faculty Publications. 213.
https://digitalcommons.unl.edu/nutritionfacpub/213
  Novelty in Biomedicine 
NBM 140   Novelty in Biomedicine 2015, 3, 140-3 
Original Article 
 
 
Cloning and Expression of EBI3 and p28 Subunits of Human 
Interleukin 27 in E. coli 
 
 
Ameneh Koochaki
1
, Mojgan Bandehpour
1,2,4*
, Sam Massahi
2
, Mahrou Sadri
3
, Bahram Kazemi
1,2,4
 
 
1 Department of Biotechnology, School of Medicine, Shahid Beheshti University of Medical Sciences, Tehran, Iran 
2 Cellular and Molecular Research Center, Shahid Beheshti University of Medical Sciences, Tehran, Iran 
3 Department of Nutrition and Health Sciences, University of Nebraska-Lincoln, Lincoln, USA 
4 Department of Biotechnology, School of Advanced Technologies in Medicine, Shahid Beheshti University of Medical Sciences, 
Tehran, Iran 
Abstract 
Background: Interleukin (IL)-27 is a heterodimeric cytokine belonging to IL-12 and IL-23 families, secreted  
by antigen presenting cells(APCs). The IL-27 is composed of 2 subunits: Epstein-Barr virus induced gene 3 
(EBI3) and p28. IL-27 is an anti-inflammatory cytokine which has an inhibitory effect on Th17 population and 
suppress the IL-17 expression. It is suggested that IL-27 could be a potent drug candidate for treating auto 
immune diseases. 
Materials and Methods: The EBI3 and p28 subunits of human interleukin 27 were constructed into plasmid 
vectors; they sub-cloned into pETDuet-1 expression vector in restriction sites of BamHI, SacI and NotI. 
Subsequently the induction was carried out by 1mM IPTG and the recombinant proteins were confirmed by 
SDS-PAGE and Western Blot analysis using anti His-tag antibody. 
Results: The EBI3 and p28 subunits of human interleukin 27were cloned into plasmid vectors. The 28 and 
25kDa protein bands were observed on SDS-PAGE and finally confirmed by Western blot technique. 
Conclusion: In this research p28 and EBI3 proteins were produced successfully. 
Keywords: Cytokine, Cloning, Recombinant protein 
 
*Corresponding Author: Mojgan Bandehpour, Department of Biotechnology, School of Advanced Technologies in Medicine, Shahid 
Beheshti University of Medical Sciences, Tehran, Iran. Email: Bandehpour@gmail.com 
 
Please cite this article as: Koochaki A, Bandehpour M, Massahi S, Sadri  M, Kazemi B. Cloning and Expression of EBI3 and p28 
Subunits of Human Interleukin 27 in E. coli. Novel Biomed. 2015;3(3):140-3. 
 
 
 
Introduction 
IL-27 is a heterodimer protein containing Epstein-
Barr-induced gene 3 (EB13) protein and also is a 
member of interleukin 12 and 23 families. This 
cytokine is a very important factor in association 
with the differentiation of Th1 lymphocytes and has a 
close relation with enhancers of cellular immune 
responses and also inhibitors of Th2 humoral 
immunity
1
 and may affect other cells such as Th17 
and B lymphocytesor NK cells
2
. In comparison with 
other cytokines, the subunits of IL-12 and IL-27 
families are non-covalently bonded; therefore, the two 
subunits are produced by different cells and then they 
bind together in the extra cellular areas
3
.IL-27 is an 
anti-tumor cytokine and inhibits angiogenesis.There 
has been seen a relation between IL-27 and induction 
of MHC class I in TBJ cells (neurocytic tumor). 
Furthermore there are some researches that have 
showed a decrease in the number of CD8+ 
lymphocytes that has led to IL-27 anti-tumoral effect 
in colon cancer cells and glial cells
4
. 
Cloning and Expression of EBI3 and p28 Subunits of Human Interleukin 27 in E. coli                                           Koochaki et al. 
NBM 141 Novelty in Biomedicine 2015, 3, 140-3 
Low expression of MHC I and reduced function of 
IL-21 receptors have substantially decreased anti-
tumoral effect of IL-27 in B10F16 melanoma. 
Transferring of IL-27 into tumoral cells has resulted 
in tumoral cells with lower density and slower 
growth rate compared to the primary tumors
5
. IL-27 
has a role in decreasing metastasis possibility with 
about 98 percent beside its inhibitory capacity in 
tumor angiogenesis
1
. 
IL-27 is a choice to treat autoimmune diseases. Since 
this is an anti-inflammatory agent and inhibits the 
increase of IL-17, it can be used as a therapeutic 
potential to treat autoimmune diseases such as 
Multiple Sclerosis, Rheumatoid Arthritisand 
Psoriasis Vulgaris. It can also inhibit and reduce the 
severity of EAE
2
 in the mice infected with MS 
6,7
. 
Animal based studies on CIA Arthritis model showed 
that IL-27 inhibits the expression of transcription 
essential factors
8
.  
IL-27 is an anti-viral agent and reduces replication of 
HIV-1 in CD4+ T cells, peripheral blood 
mononuclear cells (PBMCS) and macrophages
9
. IL-
27 induces the expression of interferon type 1 and 
IFN regulatory genes
10
. Based on mentioned 
researches, recombinant IL-27 is appropriate for 
medical care and treatment of viruses especially 
AIDS
11
. 
Interleukin 27 like other Cytokines has the main role 
in inducing and limiting of inflammations
12
. It has 
the potential to empower early phase of immune 
response, inhibits Th2 and plays a role in the 
differentiation of Th17. The main 
immunosuppressive role of this interleukin, which is 
associated with inhibition of IL-2 and opposition to 
IL-6, is to suppress the progression of Th17 and to 
induce the production of IL-10, and to activate the 
expression of suppressors-of-cytokine-signaling 
(SOCS)
13,14
. 
The role of IL-27, especially in cancers, Multiple 
Sclerosis, and Rheumatoid Arthritisfurther the 
activity of IL-27 may facilitate toprove IL-27 
recombinant form as a drug for these diseases. 
Methods 
EP repairing P28 and EBI3 Segments 
Nucleotide sequence of the genes encoding P28                         
(NM_145659.3), and EBI3 (NM_005755.2) subunits 
were taken from NCBI. These sequences were 
changed based on E. coli (host) amino acid codon 
usage and synthesized by Gene ray Biotechnology. 
The primers were designed (Table 1) and 
amplification of EBI3 (690bp) and p28 (759bp) genes 
were carried out and final fragments contain 
SacI/NotIandSacI/BamHI restriction sites in the two 
ends respectively. 
PCR was conducted using the following ingredients 
1µg plasmid, 0.2mM dNTPs, 10 mM MgCl2, 1× PCR 
buffer, 2 pmol of each reverse and forward primer, 1U 
Taq DNA polymerase (Cinagen, Iran) and water was 
added up to the final volume of  30µL.  
The following PCR program was used 
Denaturation at 94°C for 30 seconds, annealing at 
68°C for 30 seconds, and extension at 72°C for 40 
seconds; cycles were repeated for 30 times. At the 
beginning and end of the reaction, the adjusted 
temperatures (94 and 72°C) were fixed for 5 minutes. 
amplicons were detected by electrophoresis on 1.5% 
agarose gel and results were observed under UV light 
by SYBR Green.  
Gene Segments Cloning into Expression Vector 
pET Duet-1 
The PCR products, digested by the restriction 
enzymes. Final products were electrophoresed on 
agarose gel, and were recovered using a specific kit 
(Bioneer, Korea). Expression plasmid pET Duet-1 was 
digested by restriction enzymes on both sided of the 
inserts. The ligation of inserts into vectors was carried 
out by using T4 DNA Ligase (Fermentas, 
Lithuania)15. 
The cloning of these two genes were confirmed by 
universal PCR and sequencing of PCR product. 
 
Table 1: EBI3 and P28 specific primers. 
 
EBI3  
primers 
F: 
5’AGATCTCAGAGCTCATGACCCCGCAGCTTCTC 
3’ 
R: 
5’CGTGGCCGCGGCCGCCTACTTGCCCAGGCTC3’ 
p28 
primers 
 
F: 
5’AGATCTCAGAGCTCATGACCCCGCAGCTTCTC 
3’ 
R: 5’ACCGGTGGAGCTCATCAGGGCTGGGGGCTC 
3’ 
 
Koochaki et al.                                             Cloning and Expression of EBI3 and p28 Subunits of Human Interleukin 27 in E. coli 
NBM                                                                            142                                   Novelty in Biomedicine 2015, 3, 140-3 
Expression of Recombinant Proteins EBI3 and 
p28 
Recombinant pET Duet-1 plasmids containing EBI3 
and p28 were transformed into E. coli BL21 on LB 
agar media with ampicillin. Cells with recombinant 
plasmids were cultured in LB broth at 37°C and 
incubate overnight in 200 rpm. 1mM IPTG has been 
used for induction of it. After different 
hourssediment samples were collected. Proteins of 
each sample were prepared for electrophoresis on 
15% SDS-PAGE gel, the non-recombinant bacteria 
were used as negative control. To approve the 
expression of proteins in the bacteria, Western Blot 
test was conducted using specific his-tag conjugated 
antibody. 
Results 
Amplification of EBI3 and p28 Fragments 
PCR was performed by the specific primers for both 
EBI3 and P28 genes 
(Figure 1a and b). 
Cloning confirmation of genes 
After sub-cloning of EBI3 and p28 genes, PCR was 
performed by pET-Duet1 universal primers. The 
PCR products were electrophoresed on agarose gel 
1.5% (Figure 2). 
EBI3 and P28 Expression and Approved by 
Western-Blotting 
The expressions of proteins were induced using 1mM 
IPTG. The samples were electrophoresed on 12% SDS-
PAGE gel and transferred to nitrocellulose membrane. 
Western-blot analysis by alkaline phosphatase 
conjugated His-Tag antibody revealed the protein bands 
(Figure 3). 
Discussion 
Studies conducted on IL-27 showed that it can affect 
the growth and density of tumors and also can inhibit 
angiogenesis
5
 of early tumors and metastasis
1
. So 
scientists believe that IL-27 can help the treatment of 
tumors
8
.Since IL-27 is an anti-inflammatory agent 
and inhibits IL-17, it can be introduced as a 
therapeutic agent against autoimmune diseases
7
. It 
can also be considered as a strong obstacle for HIV-1 
replication
9
. Based on previous reports recombinant 
IL-27 can be used in the treatment of viral infections, 
especially AIDS
11
. Considering the extensive 
biological properties of this valuable cytokine, and the 
importance of this factor in the treatment and its 
pharmaceutical role, and considering the results of 
other researches, the authors of the current study 
decided to produce two subunits of IL-27 in vitro 
using one of the recombinant protein production 
techniques
13
. At the present study, we used pre-
synthesized genes for the experiment. 
Pflanz et al. evaluate the early identification of IL-27
3
. 
Hu et al. also performed pig P28 subunits cloning
16
. 
 
 
Figure 1. P28 (a) and EBI3 (b) PCR Products against 100bp 
DNA Ladder 
 
 
 
Figure 2. The Confirmation of EBI3 and P28 cloning by 
Universal PCR 
 
 
 
Figure 3. Western Blot analysis of EBI3 and P28 
 
Cloning and Expression of EBI3 and p28 Subunits of Human Interleukin 27 in E. coli                                           Koochaki et al. 
NBM 143 Novelty in Biomedicine 2015, 3, 140-3 
The applied method is common for cloning and has 
been used in different studies
17
. Lack of disulfide 
bond in IL-27 allows these two subunits to be 
produced by different cells and be conjugated 
together in the extracellular space. Evaluation of pure 
IL-27 p28 or EBI3 biological activity in vitro showed 
that any one of them individually is active and does 
not need another one
13
. The aforementioned results 
confirm the separate expression of EBI3 and P28 in 
different vectors of the current study, since 
evaluating the performance and role of these subunits 
by separate proteins leads more useful results. To 
express IL-27 subunits in the E. coli expression 
system, the pET Duet-1 expression vector was used. 
There are different plasmid vectors to express genes 
in E. coli, including pGEX, pQE30 and pET vectors. 
Phage T7 promoter was used in pET system, it is a 
specific strong promoter and RNA polymerase of E. 
coli cannot recognize it, while promoters of pGEX 
and pQE are transcribed by E. coli RNA 
polymerase
18
. Expression of IL-27 subunits by pET 
Duet-1 vector resulted in the production of IL-27 
subunits which any one of them is observed as a 
separate band in the competent bacteria. The results 
of the current study showed that this system is a 
suitable host to produce the recombinant IL-27 and 
using bacterial system (BL21DE3) is a quick and less 
costly method. The current study is the first report for 
human IL-27 gene cloning and expression in Iran. 
Conclusion 
In this research p28 and EBI3 recombinant proteins 
were produced in prokaryotic system successfully. 
Acknowledgements 
This project was extracted from Koochaki’s thesis 
and was carried out in Cellular and Molecular 
Research Center and Biotechnology department of 
Shahid Beheshti University of Medical Sciences. 
References 
1. Jankowski M, Kopiński P, Goc A.  Interleukin-27: Biological 
Properties and Clinical Application. Arch ImmunolTher Exp. 
2010;58:417–25. 
2. Diveu C, McGeachy M, Boniface K, et al. IL-27 blocks RORc 
expression to inhibit lineage commitment of Th17 Cells. J Immunol. 
2009;182:5748. 
3. Pflanz S, Timans JC, Cheung J, et al. IL-27, a heterodimeric 
cytokine composed of EBI3 and p28 protein, induces proliferation of 
naive CD4 +T cells. Immunity. 2002;16:779–90. 
4.  Yuan X, Hu J, Yoshimoto T et al. Bone marrow derived neural 
stem-like cells expressing IL-27 exhibit antitumor activity in 
intracranial gliomas. MolTher.2005;11:S268. 
5. Shimizu M, Shimamura M, Owaki T, et al. Antiangiogenic and 
antitumor activities of IL-27. J Immunol. 2006;176:7317–24. 
6. Batten M, Li J, Yi S, et al. Interleukin 27 limits autoimmune 
encephalomyelitis by suppressing the development of interleukin 17-
producing T cells. Nat Immunol. 2006;7:929–36. 
7.  Fitzgerald DC, Ciric B, Touil T, et al. Suppressive effect of IL-27 
on encephalitogenic Th17 cells and the effector phase of 
experimental autoimmune encephalomyelitis. J Immunol. 
2007;179:3268–3275. 
8. Furukawa M, Takaishi H, Takito J et al.IL-27 abrogates receptor 
activator of NF-kappaB ligand-mediated osteoclastogenesis of human 
granulocyte-macrophage colony-forming unit cells through STAT1-
dependent inhibition of  c-Fos. J Immunol. 2009;183:2397–406. 
9. Fakruddin JM, Lempicki RA, Gorelick RJ, et al. Noninfectious 
papilloma virus-like particles inhibit HIV-1 replication: implications 
for immune control of HIV-1 infection by IL-27. Blood. 
2007;109:1841–9. 
10. Bender H, Wiesinger M, Nordhoff C, et al. Interleukin-27 
displays interferon-gamma-like functions in human hepatoma cells 
and hepatocytes. Hepatol. 2009;50:585–91. 
11. Greenwell-Wild T, Vazquez N, Jin W, et al. IL-27 inhibition of 
HIV-1 involves an intermediate induction of type I interferon. Blood. 
2009;114:1864–74. 
12. Lucas S, Ghilardi N, Li J, et al. IL-27 regulates IL-12 
responsiveness of naive CD4+ T cells through Stat1-dependent and -
independent mechanisms. Proc Natl Acad Sci USA. 
2003;100:15047–52. 
13. Marcel B. The biology and therapeutic potential of interleukin 27. 
J Mol Med. 2007;85:661–72. 
14. Hiroki Y, Mako N, Yoshiyuki M.Interleukin 27: a double-edged 
sword for offense and defense.  Leukocyte Biol. 2009;86:1295–303. 
15. Bandehpour M, Khodabandeh M, Kazemi B. Cloning and 
Expression of Hepatitis B virus Surface Antigen. Hepat Month. 
2008;8(1):17-21.  
16. Hu P, Peng M, Chen M, Hu H, Tang L, Tang K, Ren H. 
Molecular cloning, expression and characterization of an 
interleukin27 p28 homolog in pig (Susscrofa). Veterinary Immunol 
and Immunopath. 2009;130:262–7. 
17. Lotfipour F, Hassanpour R, Farajnia S. Cloning and Expression 
of human IL-11 in E. coli. Pharma Sci. 2010;15: 353-9. 
18. Tan H, Dan G, Gong H, Cao L. Purification and characterization 
of recombinant truncated human interleukin-11 expressed as fusion 
protein in Escherichia coli. Biotechnology Letters. 2005;27:905-10. 
 
 


Cloning and Expression of EBI3 and p28 Subunits of Human Interleukin 27 in E. coli

DigitalCommons@University of Nebraska

University of Nebraska - LincolnDigitalCommons@University of Nebraska - LincolnNutrition and Health Sciences -- FacultyPublications Nutrition and Health Sciences, Department of2015Cloning and Expression of EBI3 and p28 Subunitsof Human Interleukin 27 in E. coliAmeneh KoochakiShahid Beheshti University of Medical SciencesMojgan BandehpourShahid Beheshti University of Medical Sciences, Bandehpour@gmail.comSam MassahiShahid Beheshti University of Medical SciencesMahrou SadriUniversity of Nebraska-LincolnBahram KazemiShahid Beheshti University of Medical SciencesFollow this and additional works at: https://digitalcommons.unl.edu/nutritionfacpubPart of the Human and Clinical Nutrition Commons, Molecular, Genetic, and BiochemicalNutrition Commons, and the Other Nutrition CommonsThis Article is brought to you for free and open access by the Nutrition and Health Sciences, Department of at DigitalCommons@University ofNebraska - Lincoln. It has been accepted for inclusion in Nutrition and Health Sciences -- Faculty Publications by an authorized administrator ofDigitalCommons@University of Nebraska - Lincoln.Koochaki, Ameneh; Bandehpour, Mojgan; Massahi, Sam; Sadri, Mahrou; and Kazemi, Bahram, "Cloning and Expression of EBI3 andp28 Subunits of Human Interleukin 27 in E. coli" (2015). Nutrition and Health Sciences -- Faculty Publications. 213.https://digitalcommons.unl.edu/nutritionfacpub/213  Novelty in Biomedicine NBM 140   Novelty in Biomedicine 2015, 3, 140-3 Original Article   Cloning and Expression of EBI3 and p28 Subunits of Human Interleukin 27 in E. coli   Ameneh Koochaki1, Mojgan Bandehpour1,2,4*, Sam Massahi2, Mahrou Sadri3, Bahram Kazemi1,2,4  1 Department of Biotechnology, School of Medicine, Shahid Beheshti University of Medical Sciences, Tehran, Iran 2 Cellular and Molecular Research Center, Shahid Beheshti University of Medical Sciences, Tehran, Iran 3 Department of Nutrition and Health Sciences, University of Nebraska-Lincoln, Lincoln, USA 4 Department of Biotechnology, School of Advanced Technologies in Medicine, Shahid Beheshti University of Medical Sciences, Tehran, Iran Abstract Background: Interleukin (IL)-27 is a heterodimeric cytokine belonging to IL-12 and IL-23 families, secreted  by antigen presenting cells(APCs). The IL-27 is composed of 2 subunits: Epstein-Barr virus induced gene 3 (EBI3) and p28. IL-27 is an anti-inflammatory cytokine which has an inhibitory effect on Th17 population and suppress the IL-17 expression. It is suggested that IL-27 could be a potent drug candidate for treating auto immune diseases. Materials and Methods: The EBI3 and p28 subunits of human interleukin 27 were constructed into plasmid vectors; they sub-cloned into pETDuet-1 expression vector in restriction sites of BamHI, SacI and NotI. Subsequently the induction was carried out by 1mM IPTG and the recombinant proteins were confirmed by SDS-PAGE and Western Blot analysis using anti His-tag antibody. Results: The EBI3 and p28 subunits of human interleukin 27were cloned into plasmid vectors. The 28 and 25kDa protein bands were observed on SDS-PAGE and finally confirmed by Western blot technique. Conclusion: In this research p28 and EBI3 proteins were produced successfully. Keywords: Cytokine, Cloning, Recombinant protein  *Corresponding Author: Mojgan Bandehpour, Department of Biotechnology, School of Advanced Technologies in Medicine, Shahid Beheshti University of Medical Sciences, Tehran, Iran. Email: Bandehpour@gmail.com  Please cite this article as: Koochaki A, Bandehpour M, Massahi S, Sadri  M, Kazemi B. Cloning and Expression of EBI3 and p28 Subunits of Human Interleukin 27 in E. coli. Novel Biomed. 2015;3(3):140-3.    Introduction IL-27 is a heterodimer protein containing Epstein-Barr-induced gene 3 (EB13) protein and also is a member of interleukin 12 and 23 families. This cytokine is a very important factor in association with the differentiation of Th1 lymphocytes and has a close relation with enhancers of cellular immune responses and also inhibitors of Th2 humoral immunity1 and may affect other cells such as Th17 and B lymphocytesor NK cells2. In comparison with other cytokines, the subunits of IL-12 and IL-27 families are non-covalently bonded; therefore, the two subunits are produced by different cells and then they bind together in the extra cellular areas3.IL-27 is an anti-tumor cytokine and inhibits angiogenesis.There has been seen a relation between IL-27 and induction of MHC class I in TBJ cells (neurocytic tumor). Furthermore there are some researches that have showed a decrease in the number of CD8+ lymphocytes that has led to IL-27 anti-tumoral effect in colon cancer cells and glial cells4. Cloning and Expression of EBI3 and p28 Subunits of Human Interleukin 27 in E. coli                                           Koochaki et al. NBM 141 Novelty in Biomedicine 2015, 3, 140-3 Low expression of MHC I and reduced function of IL-21 receptors have substantially decreased anti-tumoral effect of IL-27 in B10F16 melanoma. Transferring of IL-27 into tumoral cells has resulted in tumoral cells with lower density and slower growth rate compared to the primary tumors5. IL-27 has a role in decreasing metastasis possibility with about 98 percent beside its inhibitory capacity in tumor angiogenesis1. IL-27 is a choice to treat autoimmune diseases. Since this is an anti-inflammatory agent and inhibits the increase of IL-17, it can be used as a therapeutic potential to treat autoimmune diseases such as Multiple Sclerosis, Rheumatoid Arthritisand Psoriasis Vulgaris. It can also inhibit and reduce the severity of EAE2 in the mice infected with MS 6,7. Animal based studies on CIA Arthritis model showed that IL-27 inhibits the expression of transcription essential factors8.  IL-27 is an anti-viral agent and reduces replication of HIV-1 in CD4+ T cells, peripheral blood mononuclear cells (PBMCS) and macrophages9. IL-27 induces the expression of interferon type 1 and IFN regulatory genes10. Based on mentioned researches, recombinant IL-27 is appropriate for medical care and treatment of viruses especially AIDS11. Interleukin 27 like other Cytokines has the main role in inducing and limiting of inflammations12. It has the potential to empower early phase of immune response, inhibits Th2 and plays a role in the differentiation of Th17. The main immunosuppressive role of this interleukin, which is associated with inhibition of IL-2 and opposition to IL-6, is to suppress the progression of Th17 and to induce the production of IL-10, and to activate the expression of suppressors-of-cytokine-signaling (SOCS)13,14. The role of IL-27, especially in cancers, Multiple Sclerosis, and Rheumatoid Arthritisfurther the activity of IL-27 may facilitate toprove IL-27 recombinant form as a drug for these diseases. Methods EP repairing P28 and EBI3 Segments Nucleotide sequence of the genes encoding P28                         (NM_145659.3), and EBI3 (NM_005755.2) subunits were taken from NCBI. These sequences were changed based on E. coli (host) amino acid codon usage and synthesized by Gene ray Biotechnology. The primers were designed (Table 1) and amplification of EBI3 (690bp) and p28 (759bp) genes were carried out and final fragments contain SacI/NotIandSacI/BamHI restriction sites in the two ends respectively. PCR was conducted using the following ingredients 1µg plasmid, 0.2mM dNTPs, 10 mM MgCl2, 1× PCR buffer, 2 pmol of each reverse and forward primer, 1U Taq DNA polymerase (Cinagen, Iran) and water was added up to the final volume of  30µL.  The following PCR program was used Denaturation at 94°C for 30 seconds, annealing at 68°C for 30 seconds, and extension at 72°C for 40 seconds; cycles were repeated for 30 times. At the beginning and end of the reaction, the adjusted temperatures (94 and 72°C) were fixed for 5 minutes. amplicons were detected by electrophoresis on 1.5% agarose gel and results were observed under UV light by SYBR Green.  Gene Segments Cloning into Expression Vector pET Duet-1 The PCR products, digested by the restriction enzymes. Final products were electrophoresed on agarose gel, and were recovered using a specific kit (Bioneer, Korea). Expression plasmid pET Duet-1 was digested by restriction enzymes on both sided of the inserts. The ligation of inserts into vectors was carried out by using T4 DNA Ligase (Fermentas, Lithuania)15. The cloning of these two genes were confirmed by universal PCR and sequencing of PCR product.  Table 1: EBI3 and P28 specific primers.  EBI3  primers F: 5’AGATCTCAGAGCTCATGACCCCGCAGCTTCTC 3’ R: 5’CGTGGCCGCGGCCGCCTACTTGCCCAGGCTC3’ p28 primers  F: 5’AGATCTCAGAGCTCATGACCCCGCAGCTTCTC 3’ R: 5’ACCGGTGGAGCTCATCAGGGCTGGGGGCTC 3’  Koochaki et al.                                             Cloning and Expression of EBI3 and p28 Subunits of Human Interleukin 27 in E. coli NBM                                                                            142                                   Novelty in Biomedicine 2015, 3, 140-3 Expression of Recombinant Proteins EBI3 and p28 Recombinant pET Duet-1 plasmids containing EBI3 and p28 were transformed into E. coli BL21 on LB agar media with ampicillin. Cells with recombinant plasmids were cultured in LB broth at 37°C and incubate overnight in 200 rpm. 1mM IPTG has been used for induction of it. After different hourssediment samples were collected. Proteins of each sample were prepared for electrophoresis on 15% SDS-PAGE gel, the non-recombinant bacteria were used as negative control. To approve the expression of proteins in the bacteria, Western Blot test was conducted using specific his-tag conjugated antibody. Results Amplification of EBI3 and p28 Fragments PCR was performed by the specific primers for both EBI3 and P28 genes (Figure 1a and b). Cloning confirmation of genes After sub-cloning of EBI3 and p28 genes, PCR was performed by pET-Duet1 universal primers. The PCR products were electrophoresed on agarose gel 1.5% (Figure 2). EBI3 and P28 Expression and Approved by Western-Blotting The expressions of proteins were induced using 1mM IPTG. The samples were electrophoresed on 12% SDS-PAGE gel and transferred to nitrocellulose membrane. Western-blot analysis by alkaline phosphatase conjugated His-Tag antibody revealed the protein bands (Figure 3). Discussion Studies conducted on IL-27 showed that it can affect the growth and density of tumors and also can inhibit angiogenesis5 of early tumors and metastasis1. So scientists believe that IL-27 can help the treatment of tumors8.Since IL-27 is an anti-inflammatory agent and inhibits IL-17, it can be introduced as a therapeutic agent against autoimmune diseases7. It can also be considered as a strong obstacle for HIV-1 replication9. Based on previous reports recombinant IL-27 can be used in the treatment of viral infections, especially AIDS11. Considering the extensive biological properties of this valuable cytokine, and the importance of this factor in the treatment and its pharmaceutical role, and considering the results of other researches, the authors of the current study decided to produce two subunits of IL-27 in vitro using one of the recombinant protein production techniques13. At the present study, we used pre-synthesized genes for the experiment. Pflanz et al. evaluate the early identification of IL-273. Hu et al. also performed pig P28 subunits cloning16.   Figure 1. P28 (a) and EBI3 (b) PCR Products against 100bp DNA Ladder    Figure 2. The Confirmation of EBI3 and P28 cloning by Universal PCR    Figure 3. Western Blot analysis of EBI3 and P28  Cloning and Expression of EBI3 and p28 Subunits of Human Interleukin 27 in E. coli                                           Koochaki et al. NBM 143 Novelty in Biomedicine 2015, 3, 140-3 The applied method is common for cloning and has been used in different studies17. Lack of disulfide bond in IL-27 allows these two subunits to be produced by different cells and be conjugated together in the extracellular space. Evaluation of pure IL-27 p28 or EBI3 biological activity in vitro showed that any one of them individually is active and does not need another one13. The aforementioned results confirm the separate expression of EBI3 and P28 in different vectors of the current study, since evaluating the performance and role of these subunits by separate proteins leads more useful results. To express IL-27 subunits in the E. coli expression system, the pET Duet-1 expression vector was used. There are different plasmid vectors to express genes in E. coli, including pGEX, pQE30 and pET vectors. Phage T7 promoter was used in pET system, it is a specific strong promoter and RNA polymerase of E. coli cannot recognize it, while promoters of pGEX and pQE are transcribed by E. coli RNA polymerase18. Expression of IL-27 subunits by pET Duet-1 vector resulted in the production of IL-27 subunits which any one of them is observed as a separate band in the competent bacteria. The results of the current study showed that this system is a suitable host to produce the recombinant IL-27 and using bacterial system (BL21DE3) is a quick and less costly method. The current study is the first report for human IL-27 gene cloning and expression in Iran. Conclusion In this research p28 and EBI3 recombinant proteins were produced in prokaryotic system successfully. Acknowledgements This project was extracted from Koochaki’s thesis and was carried out in Cellular and Molecular Research Center and Biotechnology department of Shahid Beheshti University of Medical Sciences. References 1. Jankowski M, Kopiński P, Goc A.  Interleukin-27: Biological Properties and Clinical Application. Arch ImmunolTher Exp. 2010;58:417–25. 2. Diveu C, McGeachy M, Boniface K, et al. IL-27 blocks RORc expression to inhibit lineage commitment of Th17 Cells. J Immunol. 2009;182:5748. 3. Pflanz S, Timans JC, Cheung J, et al. IL-27, a heterodimeric cytokine composed of EBI3 and p28 protein, induces proliferation of naive CD4 +T cells. Immunity. 2002;16:779–90. 4.  Yuan X, Hu J, Yoshimoto T et al. Bone marrow derived neural stem-like cells expressing IL-27 exhibit antitumor activity in intracranial gliomas. MolTher.2005;11:S268. 5. Shimizu M, Shimamura M, Owaki T, et al. Antiangiogenic and antitumor activities of IL-27. J Immunol. 2006;176:7317–24. 6. Batten M, Li J, Yi S, et al. Interleukin 27 limits autoimmune encephalomyelitis by suppressing the development of interleukin 17-producing T cells. Nat Immunol. 2006;7:929–36. 7.  Fitzgerald DC, Ciric B, Touil T, et al. Suppressive effect of IL-27 on encephalitogenic Th17 cells and the effector phase of experimental autoimmune encephalomyelitis. J Immunol. 2007;179:3268–3275. 8. Furukawa M, Takaishi H, Takito J et al.IL-27 abrogates receptor activator of NF-kappaB ligand-mediated osteoclastogenesis of human granulocyte-macrophage colony-forming unit cells through STAT1-dependent inhibition of  c-Fos. J Immunol. 2009;183:2397–406. 9. Fakruddin JM, Lempicki RA, Gorelick RJ, et al. Noninfectious papilloma virus-like particles inhibit HIV-1 replication: implications for immune control of HIV-1 infection by IL-27. Blood. 2007;109:1841–9. 10. Bender H, Wiesinger M, Nordhoff C, et al. Interleukin-27 displays interferon-gamma-like functions in human hepatoma cells and hepatocytes. Hepatol. 2009;50:585–91. 11. Greenwell-Wild T, Vazquez N, Jin W, et al. IL-27 inhibition of HIV-1 involves an intermediate induction of type I interferon. Blood. 2009;114:1864–74. 12. Lucas S, Ghilardi N, Li J, et al. IL-27 regulates IL-12 responsiveness of naive CD4+ T cells through Stat1-dependent and -independent mechanisms. Proc Natl Acad Sci USA. 2003;100:15047–52. 13. Marcel B. The biology and therapeutic potential of interleukin 27. J Mol Med. 2007;85:661–72. 14. Hiroki Y, Mako N, Yoshiyuki M.Interleukin 27: a double-edged sword for offense and defense.  Leukocyte Biol. 2009;86:1295–303. 15. Bandehpour M, Khodabandeh M, Kazemi B. Cloning and Expression of Hepatitis B virus Surface Antigen. Hepat Month. 2008;8(1):17-21.  16. Hu P, Peng M, Chen M, Hu H, Tang L, Tang K, Ren H. Molecular cloning, expression and characterization of an interleukin27 p28 homolog in pig (Susscrofa). Veterinary Immunol and Immunopath. 2009;130:262–7. 17. Lotfipour F, Hassanpour R, Farajnia S. Cloning and Expression of human IL-11 in E. coli. Pharma Sci. 2010;15: 353-9. 18. Tan H, Dan G, Gong H, Cao L. Purification and characterization of recombinant truncated human interleukin-11 expressed as fusion protein in Escherichia coli. Biotechnology Letters. 2005;27:905-10.   

Journals Portal, Shahid Beheshti University of Medical Sciences

  Novelty in Biomedicine NBM 140   Novelty in Biomedicine 2015, 3, 140-3 Original Article   Cloning and Expression of EBI3 and p28 Subunits of Human Interleukin 27 in E. coli   Ameneh Koochaki1, Mojgan Bandehpour1,2,4*, Sam Massahi2, Mahrou Sadri3, Bahram Kazemi1,2,4  1 Department of Biotechnology, School of Medicine, Shahid Beheshti University of Medical Sciences, Tehran, Iran 2 Cellular and Molecular Research Center, Shahid Beheshti University of Medical Sciences, Tehran, Iran 3 Department of Nutrition and Health Sciences, University of Nebraska-Lincoln, Lincoln, USA 4 Department of Biotechnology, School of Advanced Technologies in Medicine, Shahid Beheshti University of Medical Sciences, Tehran, Iran Abstract Background: Interleukin (IL)-27 is a heterodimeric cytokine belonging to IL-12 and IL-23 families, secreted  by antigen presenting cells(APCs). The IL-27 is composed of 2 subunits: Epstein-Barr virus induced gene 3 (EBI3) and p28. IL-27 is an anti-inflammatory cytokine which has an inhibitory effect on Th17 population and suppress the IL-17 expression. It is suggested that IL-27 could be a potent drug candidate for treating auto immune diseases. Materials and Methods: The EBI3 and p28 subunits of human interleukin 27 were constructed into plasmid vectors; they sub-cloned into pETDuet-1 expression vector in restriction sites of BamHI, SacI and NotI. Subsequently the induction was carried out by 1mM IPTG and the recombinant proteins were confirmed by SDS-PAGE and Western Blot analysis using anti His-tag antibody. Results: The EBI3 and p28 subunits of human interleukin 27were cloned into plasmid vectors. The 28 and 25kDa protein bands were observed on SDS-PAGE and finally confirmed by Western blot technique. Conclusion: In this research p28 and EBI3 proteins were produced successfully. Keywords: Cytokine, Cloning, Recombinant protein  *Corresponding Author: Mojgan Bandehpour, Department of Biotechnology, School of Advanced Technologies in Medicine, Shahid Beheshti University of Medical Sciences, Tehran, Iran. Email: Bandehpour@gmail.com  Please cite this article as: Koochaki A, Bandehpour M, Massahi S, Sadri  M, Kazemi B. Cloning and Expression of EBI3 and p28 Subunits of Human Interleukin 27 in E. coli. Novel Biomed. 2015;3(3):140-3.    Introduction IL-27 is a heterodimer protein containing Epstein-Barr-induced gene 3 (EB13) protein and also is a member of interleukin 12 and 23 families. This cytokine is a very important factor in association with the differentiation of Th1 lymphocytes and has a close relation with enhancers of cellular immune responses and also inhibitors of Th2 humoral immunity1 and may affect other cells such as Th17 and B lymphocytesor NK cells2. In comparison with other cytokines, the subunits of IL-12 and IL-27 families are non-covalently bonded; therefore, the two subunits are produced by different cells and then they bind together in the extra cellular areas3.IL-27 is an anti-tumor cytokine and inhibits angiogenesis.There has been seen a relation between IL-27 and induction of MHC class I in TBJ cells (neurocytic tumor). Furthermore there are some researches that have showed a decrease in the number of CD8+ lymphocytes that has led to IL-27 anti-tumoral effect in colon cancer cells and glial cells4. Cloning and Expression of EBI3 and p28 Subunits of Human Interleukin 27 in E. coli                                           Koochaki et al. NBM 141 Novelty in Biomedicine 2015, 3, 140-3 Low expression of MHC I and reduced function of IL-21 receptors have substantially decreased anti-tumoral effect of IL-27 in B10F16 melanoma. Transferring of IL-27 into tumoral cells has resulted in tumoral cells with lower density and slower growth rate compared to the primary tumors5. IL-27 has a role in decreasing metastasis possibility with about 98 percent beside its inhibitory capacity in tumor angiogenesis1. IL-27 is a choice to treat autoimmune diseases. Since this is an anti-inflammatory agent and inhibits the increase of IL-17, it can be used as a therapeutic potential to treat autoimmune diseases such as Multiple Sclerosis, Rheumatoid Arthritisand Psoriasis Vulgaris. It can also inhibit and reduce the severity of EAE2 in the mice infected with MS 6,7. Animal based studies on CIA Arthritis model showed that IL-27 inhibits the expression of transcription essential factors8.  IL-27 is an anti-viral agent and reduces replication of HIV-1 in CD4+ T cells, peripheral blood mononuclear cells (PBMCS) and macrophages9. IL-27 induces the expression of interferon type 1 and IFN regulatory genes10. Based on mentioned researches, recombinant IL-27 is appropriate for medical care and treatment of viruses especially AIDS11. Interleukin 27 like other Cytokines has the main role in inducing and limiting of inflammations12. It has the potential to empower early phase of immune response, inhibits Th2 and plays a role in the differentiation of Th17. The main immunosuppressive role of this interleukin, which is associated with inhibition of IL-2 and opposition to IL-6, is to suppress the progression of Th17 and to induce the production of IL-10, and to activate the expression of suppressors-of-cytokine-signaling (SOCS)13,14. The role of IL-27, especially in cancers, Multiple Sclerosis, and Rheumatoid Arthritisfurther the activity of IL-27 may facilitate toprove IL-27 recombinant form as a drug for these diseases. Methods EP repairing P28 and EBI3 Segments Nucleotide sequence of the genes encoding P28                         (NM_145659.3), and EBI3 (NM_005755.2) subunits were taken from NCBI. These sequences were changed based on E. coli (host) amino acid codon usage and synthesized by Gene ray Biotechnology. The primers were designed (Table 1) and amplification of EBI3 (690bp) and p28 (759bp) genes were carried out and final fragments contain SacI/NotIandSacI/BamHI restriction sites in the two ends respectively. PCR was conducted using the following ingredients 1µg plasmid, 0.2mM dNTPs, 10 mM MgCl2, 1× PCR buffer, 2 pmol of each reverse and forward primer, 1U Taq DNA polymerase (Cinagen, Iran) and water was added up to the final volume of  30µL.  The following PCR program was used Denaturation at 94°C for 30 seconds, annealing at 68°C for 30 seconds, and extension at 72°C for 40 seconds; cycles were repeated for 30 times. At the beginning and end of the reaction, the adjusted temperatures (94 and 72°C) were fixed for 5 minutes. amplicons were detected by electrophoresis on 1.5% agarose gel and results were observed under UV light by SYBR Green.  Gene Segments Cloning into Expression Vector pET Duet-1 The PCR products, digested by the restriction enzymes. Final products were electrophoresed on agarose gel, and were recovered using a specific kit (Bioneer, Korea). Expression plasmid pET Duet-1 was digested by restriction enzymes on both sided of the inserts. The ligation of inserts into vectors was carried out by using T4 DNA Ligase (Fermentas, Lithuania)15. The cloning of these two genes were confirmed by universal PCR and sequencing of PCR product.  Table 1: EBI3 and P28 specific primers.  EBI3  primers F: 5’AGATCTCAGAGCTCATGACCCCGCAGCTTCTC 3’ R: 5’CGTGGCCGCGGCCGCCTACTTGCCCAGGCTC3’ p28 primers  F: 5’AGATCTCAGAGCTCATGACCCCGCAGCTTCTC 3’ R: 5’ACCGGTGGAGCTCATCAGGGCTGGGGGCTC 3’  Koochaki et al.                                             Cloning and Expression of EBI3 and p28 Subunits of Human Interleukin 27 in E. coli NBM                                                                            142                                   Novelty in Biomedicine 2015, 3, 140-3 Expression of Recombinant Proteins EBI3 and p28 Recombinant pET Duet-1 plasmids containing EBI3 and p28 were transformed into E. coli BL21 on LB agar media with ampicillin. Cells with recombinant plasmids were cultured in LB broth at 37°C and incubate overnight in 200 rpm. 1mM IPTG has been used for induction of it. After different hourssediment samples were collected. Proteins of each sample were prepared for electrophoresis on 15% SDS-PAGE gel, the non-recombinant bacteria were used as negative control. To approve the expression of proteins in the bacteria, Western Blot test was conducted using specific his-tag conjugated antibody. Results Amplification of EBI3 and p28 Fragments PCR was performed by the specific primers for both EBI3 and P28 genes (Figure 1a and b). Cloning confirmation of genes After sub-cloning of EBI3 and p28 genes, PCR was performed by pET-Duet1 universal primers. The PCR products were electrophoresed on agarose gel 1.5% (Figure 2). EBI3 and P28 Expression and Approved by Western-Blotting The expressions of proteins were induced using 1mM IPTG. The samples were electrophoresed on 12% SDS-PAGE gel and transferred to nitrocellulose membrane. Western-blot analysis by alkaline phosphatase conjugated His-Tag antibody revealed the protein bands (Figure 3). Discussion Studies conducted on IL-27 showed that it can affect the growth and density of tumors and also can inhibit angiogenesis5 of early tumors and metastasis1. So scientists believe that IL-27 can help the treatment of tumors8.Since IL-27 is an anti-inflammatory agent and inhibits IL-17, it can be introduced as a therapeutic agent against autoimmune diseases7. It can also be considered as a strong obstacle for HIV-1 replication9. Based on previous reports recombinant IL-27 can be used in the treatment of viral infections, especially AIDS11. Considering the extensive biological properties of this valuable cytokine, and the importance of this factor in the treatment and its pharmaceutical role, and considering the results of other researches, the authors of the current study decided to produce two subunits of IL-27 in vitro using one of the recombinant protein production techniques13. At the present study, we used pre-synthesized genes for the experiment. Pflanz et al. evaluate the early identification of IL-273. Hu et al. also performed pig P28 subunits cloning16.   Figure 1. P28 (a) and EBI3 (b) PCR Products against 100bp DNA Ladder    Figure 2. The Confirmation of EBI3 and P28 cloning by Universal PCR    Figure 3. Western Blot analysis of EBI3 and P28  Cloning and Expression of EBI3 and p28 Subunits of Human Interleukin 27 in E. coli                                           Koochaki et al. NBM 143 Novelty in Biomedicine 2015, 3, 140-3 The applied method is common for cloning and has been used in different studies17. Lack of disulfide bond in IL-27 allows these two subunits to be produced by different cells and be conjugated together in the extracellular space. Evaluation of pure IL-27 p28 or EBI3 biological activity in vitro showed that any one of them individually is active and does not need another one13. The aforementioned results confirm the separate expression of EBI3 and P28 in different vectors of the current study, since evaluating the performance and role of these subunits by separate proteins leads more useful results. To express IL-27 subunits in the E. coli expression system, the pET Duet-1 expression vector was used. There are different plasmid vectors to express genes in E. coli, including pGEX, pQE30 and pET vectors. Phage T7 promoter was used in pET system, it is a specific strong promoter and RNA polymerase of E. coli cannot recognize it, while promoters of pGEX and pQE are transcribed by E. coli RNA polymerase18. Expression of IL-27 subunits by pET Duet-1 vector resulted in the production of IL-27 subunits which any one of them is observed as a separate band in the competent bacteria. The results of the current study showed that this system is a suitable host to produce the recombinant IL-27 and using bacterial system (BL21DE3) is a quick and less costly method. The current study is the first report for human IL-27 gene cloning and expression in Iran. Conclusion In this research p28 and EBI3 recombinant proteins were produced in prokaryotic system successfully. Acknowledgements This project was extracted from Koochaki’s thesis and was carried out in Cellular and Molecular Research Center and Biotechnology department of Shahid Beheshti University of Medical Sciences. References 1. Jankowski M, Kopiński P, Goc A.  Interleukin-27: Biological Properties and Clinical Application. Arch ImmunolTher Exp. 2010;58:417–25. 2. Diveu C, McGeachy M, Boniface K, et al. IL-27 blocks RORc expression to inhibit lineage commitment of Th17 Cells. J Immunol. 2009;182:5748. 3. Pflanz S, Timans JC, Cheung J, et al. IL-27, a heterodimeric cytokine composed of EBI3 and p28 protein, induces proliferation of naive CD4 +T cells. Immunity. 2002;16:779–90. 4.  Yuan X, Hu J, Yoshimoto T et al. Bone marrow derived neural stem-like cells expressing IL-27 exhibit antitumor activity in intracranial gliomas. MolTher.2005;11:S268. 5. Shimizu M, Shimamura M, Owaki T, et al. Antiangiogenic and antitumor activities of IL-27. J Immunol. 2006;176:7317–24. 6. Batten M, Li J, Yi S, et al. Interleukin 27 limits autoimmune encephalomyelitis by suppressing the development of interleukin 17-producing T cells. Nat Immunol. 2006;7:929–36. 7.  Fitzgerald DC, Ciric B, Touil T, et al. Suppressive effect of IL-27 on encephalitogenic Th17 cells and the effector phase of experimental autoimmune encephalomyelitis. J Immunol. 2007;179:3268–3275. 8. Furukawa M, Takaishi H, Takito J et al.IL-27 abrogates receptor activator of NF-kappaB ligand-mediated osteoclastogenesis of human granulocyte-macrophage colony-forming unit cells through STAT1-dependent inhibition of  c-Fos. J Immunol. 2009;183:2397–406. 9. Fakruddin JM, Lempicki RA, Gorelick RJ, et al. Noninfectious papilloma virus-like particles inhibit HIV-1 replication: implications for immune control of HIV-1 infection by IL-27. Blood. 2007;109:1841–9. 10. Bender H, Wiesinger M, Nordhoff C, et al. Interleukin-27 displays interferon-gamma-like functions in human hepatoma cells and hepatocytes. Hepatol. 2009;50:585–91. 11. Greenwell-Wild T, Vazquez N, Jin W, et al. IL-27 inhibition of HIV-1 involves an intermediate induction of type I interferon. Blood. 2009;114:1864–74. 12. Lucas S, Ghilardi N, Li J, et al. IL-27 regulates IL-12 responsiveness of naive CD4+ T cells through Stat1-dependent and -independent mechanisms. Proc Natl Acad Sci USA. 2003;100:15047–52. 13. Marcel B. The biology and therapeutic potential of interleukin 27. J Mol Med. 2007;85:661–72. 14. Hiroki Y, Mako N, Yoshiyuki M.Interleukin 27: a double-edged sword for offense and defense.  Leukocyte Biol. 2009;86:1295–303. 15. Bandehpour M, Khodabandeh M, Kazemi B. Cloning and Expression of Hepatitis B virus Surface Antigen. Hepat Month. 2008;8(1):17-21.  16. Hu P, Peng M, Chen M, Hu H, Tang L, Tang K, Ren H. Molecular cloning, expression and characterization of an interleukin27 p28 homolog in pig (Susscrofa). Veterinary Immunol and Immunopath. 2009;130:262–7. 17. Lotfipour F, Hassanpour R, Farajnia S. Cloning and Expression of human IL-11 in E. coli. Pharma Sci. 2010;15: 353-9. 18. Tan H, Dan G, Gong H, Cao L. Purification and characterization of recombinant truncated human interleukin-11 expressed as fusion protein in Escherichia coli. Biotechnology Letters. 2005;27:905-10.   

Background: Interleukin-27 is a heterodimeric cytokine belonging to IL-12 and IL-23 families, secreted  by Antigen Presenting Cells(APCs) .The IL-27 is composed of 2 subunits: Epstein-Barr virus induced gene 3 (EBI3) and p28. IL-27 is an anti-inflammatory cytokine which has an inhibitory effect on Th17 population and suppress the IL-17 expression. It is suggested that IL-27 could be a potent drug candidate for treating auto immune diseases.Methods: The IL-27 subunit genes were constructed into plasmid vectors, they sub-cloned into pETDeut-1an expression vector in restriction sites of BamHI, SacI and NotI. Subsequently the induction was done by IPTG and the recombinant proteins were confirmed by SDS-PAGE and Western Blot analysis using anti His-tag antibody.Results: The 28kDa and 25kDa protein bands were observed on SDS-PAGE and finally confirmed by Western blot technique.</strong

Cloning and Expression of EBI3 and p28 Subunits of Human Interleukin 27 in E. coli

Abstract

Similar works

Full text

Available Versions

UNL | Libraries

DigitalCommons@University of Nebraska

Journals Portal, Shahid Beheshti University of Medical Sciences

Directory of Open Access Journals