Mullein (Verbascum) plants have extensive distribution and can grow in variable environmental conditions. Seed was collected from mullein plants grown at 4 locations, two metals contaminated and two metal uncontaminated areas. Genetic variability of progeny was examined. Populations collected from unpolluted areas were genetically more similar than those collected from polluted areas as revealed by RAPD and SSR markers and UPGMA analysis. The results indicate that there is genetic differentiation between examined populations and therefore they represent suitable material for further investigation of plant adaptation mechanisms to increased metal content

Danilović, Gordana

Morina, Filis

Panković, Dejana

Prokić, Ljiljana

Satović, Zlatko

Genetika

English

Mullein (Verbascum) plants have extensive distribution and can grow in
   variable environmental conditions. Seed was collected from mullein plants
   grown at 4 locations, two metals contaminated and two metal uncontaminated
   areas. Genetic variability of progeny was examined. Populations collected
   from unpolluted areas were genetically more similar than those collected from
   polluted areas as revealed by RAPD and SSR markers and UPGMA analysis. The
   results indicate that there is genetic differentiation between examined
   populations and therefore they represent suitable material for further
   investigation of plant adaptation mechanisms to increased metal content.
   [Projekat Ministarstva nauke Republike Srbije, br. III43010

Danilović Gordana

Morina Filis

Satovic Zlatko

Prokić Ljiljana

Panković Dejana

Directory of Open Access Journals

Genetic variability of Verbascum populations from metal polluted and unpolluted sites

AgroSpace

  ___________________________  Corresponding author: Dejana Panković, Faculty of Environmental Protection, Educons University, 21208 Sremska Kamenica, Serbia; Phone: +381214893667; Fax: +381214893618; E-mail: dejanapankovic@yahoo.co.uk; dejana.pankovic@educons.edu.rs      UDC 575              DOI: 10.2298/GENSR1501245D                             Original scientific paper       GENETIC VARIABILITY OF Verbascum POPULATIONS FROM METAL POLLUTED AND UNPOLLUTED SITES   Gordana DANILOVIĆ1, Filis MORINA2 Zlatko SATOVIC3, Ljiljana PROKIĆ4,  and Dejana PANKOVIĆ1  1Faculty of Environmental Protection, Educons University, Sremska Kamenica, Serbia 2Institute for Multidisciplinary Research, University of Belgrade, Belgrade, Serbia 3Faculty of Agriculture, University of Zagreb, Zagreb, Croatia 4Faculty of Agriculture, University of Belgrade, Belgrade, Serbia  Danilović G., F. Morina, Z. Satovic, Lj. Prokić, and D. Panković (2015): Genetic variability of  Verbascum populations from metal polluted and unpolluted sites.- Genetika, Vol 47, No. 1, 245-251. Mullein (Verbascum) plants have extensive distribution and can grow in variable environmental conditions. Seed was collected from mullein plants grown at 4 locations, two metals contaminated and two metal uncontaminated areas. Genetic variability of progeny was examined.  Populations collected from unpolluted areas were genetically more similar than those collected from polluted areas as revealed by RAPD and SSR markers and UPGMA analysis. The results indicate that there is genetic differentiation between examined populations and therefore they represent suitable material for further investigation of plant adaptation mechanisms to increased metal content.  Key words: metal tolerance, mullein, RAPD, SSR, UPGMA   INTRODUCTION Mullein plants (Verbascum), native to Europe and Asia, have extensive distribution and can grow in a range of diverse conditions often on disturbed sites, such as roadsides and industrial areas, as pioneer species (KUMSCHICK et al., 2013). However, mullein was introduced and spread over North America, where it is one of model plant species for the examination of invading properties. Main factors that influence invading process of a plant species are rapid adaptation and/or physiological tolerance and plasticity (PARKER et al., 2003). By investigating 246                                                                                                             GENETIKA, Vol. 47, No1, 245-251, 2015 relevant morphological and physiological traits of different V. thapsus populations and their genetic relatedness, DLUGOSCH and PARKER (2007) showed that the invasion at high elevations was caused by phenotypic plasticity rather than rapid adaptation. Other studies indicated that local adaptations might contribute to widespread invasion of multiple habitats by V. thapsus (KUMSCHICK et al., 2013). It has been shown that the ability of V. thapsus to colonize Zn contaminated industrial waste disposal and accumulate high concentrations of Zn was followed by increased antioxidative status of both leaves and roots (MORINA et al., 2008, JOVANOVIĆ et al., 2007; MORINA et al., 2010). The ability of mullein to colonize metal contaminated areas might be the result of adaptation and/or phenotypic plasticity. In order to get first information on this mechanism we have examined genetic diversity between 4 mullein populations, two  from metal contaminated  and two  from uncontaminated soils, by the use of RAPD and SSR markers.    MATERIALS AND METHODS  Seed collection Seeds from 2 controls V. thapsus L. populations (NM1 and NM2) were randomly collected in metal-uncontaminated areas: NM1 in a ruderal meadow where the soil was degraded by erosion, on mountain Zlatibor and NM2 population that was found in an urban area, on a ruderal meadow close to a preserved park-forest Kosutnjak, near Belgrade, Serbia. Third population of V. thapsus L. (M1), was an early colonizer species on a jarosite smelter, which has been in use since 2000, coming from a zinc production process (M1) in the Zorka Sabac Industry. The fourth population (M2), V. lychnitis L., was among the few species present on open cast copper mine deposits since 1990 in Majdanpek. Metal contents in soils from locations in Sabac and Majdanpek were 20 to 200 folds higher than in unpolluted soil (JOVANOVIĆ et al., 2007). Progeny of the collected populations was grown as in JOVANOVIĆ et al., (2007) and used for genetic analysis.   Experimental conditions DNA extraction and PCR amplifications  Leaf tissue, bulked from 8-10 plants, was frozen in liquid nitrogen, grinded with mortar and pestle and genomic DNA was extracted using a DNeasy mini plant kit (Quiagen, Germany).  Data on molecular markers and gene sequences in Verbascum are scarce, therefore we used RAPD and sunflower SSR markers to determine genetic distances between examined populations. RAPD-PCR amplifications were performed with 7 decamer primers (Eurofins MWG Operon, Germany) in a 20 µl volume of reaction mixture containing: 30 ng µl-1  gDNA, 0.4 mM dNTP, 1U TaqDNA polimerase (Thermo Fisher Scientific- Fermentas), 1 × Taq buffer, 0.2 µM RAPD primer, 3 mM MgCl2 and 2.5 µg µl-1 BSA. The thermocycler (Eppendorf, Germany) was programmed as follows: 5 min at 95оC, 45 cycles consisting of 1 min at 95ºC, 1 min 36ºC, 2 min at 67ºC, followed by the final extension at 67ºC for 5 minutes. Out of several Helianthus SSR primers, previously used for the investigation of cultivated and wild sunflowers (SAFTIĆ-PANKOVIĆ et al., 2005, PANKOVIĆ et al., 2007), 6 primers (Thermo Fisher Scientific- Fermentas) were used for PCR amplifications in 20 µl volume of G. DANILOVIC et al: GENETIC VARIABILITY OF Verbascum                                                                                 247 reaction mixture containing: 40 ng gDNA, 0.4 mM dNTP, 1U Taq polymerase (Thermo Fisher Scientific- Fermentas), 1 × Taq buffer, 0.6 µM SSR primers, 3 mM MgCl2 and 2,5 µg µl-1 BSA. The following PCR touch-down program was used: 3 min at 95ºC, 7 cycles of 30 seconds at 94ºC, 30 seconds at 64ºC, with the a decrease of temperature by 1 ºC in each cycle, 30 seconds at 67ºC, 33 cycles of 30 seconds on 94ºC, 30 seconds at 57ºC, 30 seconds at 67ºC, followed by the final extension at 67ºC for 20 minutes (TANG et al., 2002).The sequences of RAPD and SSR primers are given in Table 1. Amplified PCR products were separated by agarose gel electrophoresis (1% and 2% agarose for RAPD and SSR primers, respectively) in 1 × TBE running buffer, at 120 V for 60 min. Bands were visualized by in-gel ethidium bromide (0.5 µl ml-1) under UV light, by a Bio Print Analysis System (VILBER LOURMAT, France).  Molecular data analyses Interpopulational relationships of the Verbascum species were analyzed by distance-based cluster analyses, similar to those in NEJSUM et al. (2005). Amplified fragments were scored for the presence (1) or absence (0) of homologous bands to create binary matrices. Pairwise genetic distances were calculated using Jaccard's coefficient (JACCARD, 1901). A hierarchical cluster procedure was performed using a UPGMA algorithm as implemented PAST ver. 2.01 (HAMMER et al., 2001). The statistical support of the branches was tested with bootstrap analysis using 1,000 replicates (FELSENSTEIN, 1985). The characteristics of RAPD and SSR loci analyzed in Verbascum gDNA are shown in Table 1.   RESULTS  Molecular marker analysis  Polymorphism of genomic DNA was analyzed by RAPD and SSR markers. The number of amplified fragments by primers varied from 3 to 7. Size of RAPD markers varied from 500 to 3000 bp. SSR markers were smaller they ranged from 50 to 700 bp. Two of the highly polymorphic SSR markers, SSR 317 and SSR 595 (Table 1) were mapped in loci for simple inherited traits in sunflower; branching (i.e. multiple flowers) and chlorophyll deficiency, respectively (HAHN and WIECKHORST, 2010).   Twenty-six out of 47 polymorphic fragments were populations specific (unique fragments). While V. thapsus populations originating from uncontaminated areas (NM1 and NM2) had 5 unique fragments each, the populations from the metal-contaminated area (V. thapsus; M1 and V. lychnitis; M2) showed 8 unique fragments each. Pairwise genetic distances between populations varied from 0.58 (NM1 / NM2) to 0.72 (M2 / NM2), with an average of 0.67. As expected, the populations V. thapsus populations originating from uncontaminated areas (NM1 and NM2) clustered together in the UPGMA tree supported by a bootstrap value of 63% (Figure 1), while V. lychnitis population from the metal-contaminated area (NM2) was the most distant from the rest of the populations.     248                                                                                                             GENETIKA, Vol. 47, No1, 245-251, 2015  Table 1. Characteristics of RAPD and SSR loci analyzed in Verbascum gDNA  Primer name Primer sequence (5’- 3’) Number of amplified fragments Fragment size range (bp) Number of         polymorphic    fragments RAPD OPA 14 TCTGTGCTGG 7 500-1850 6 RAPD  OPA 16 AGCCAGCGAA 5 1200-1800 5 RAPD OPO 19 GGTGCACGTT 4 950-1950 4 RAPD OPC 19 GTTGCGAGCC 3 600-1700 1 RAPD   OPO 02 ACGTAGCGTC 4 650-2500 4 RAPD OPO 07 CAGCACTGC 3 1500-3000 2 RAPD  OPO 04 AAGTCCGCTC 6 500-2500 6 SSR  166  F CAGCCACATGCCCTCTGA 3 50-350 1 R TGTTAAGAACCGCGACAACTG SSR  1021  F AACCCTAATCCAACCAGATACGA 5 50-700 4 R CAACGAAAAGACAGAATCGAAA SSR  317  F TTTGGCAGTTTGGTGGCTTA 3 50-250 3 R GGTCGTATGCTTAATTCTTTCTC SSR  509  F CAACGAAAAGACAGAATCGAAA 5 50-300 4 R CCGGGAATTTTACAAGGTGA SSR  595  F TGATGGTAATGCATCGGGTA 4 50-150 4 R CACACCATCCCTTGTAAAATCA SSR  499  F CACGGTTGGTCAATCACATC 3 50-240 3 R TTTAGGCTGCACATTATGGACT    G. DANILOVIC et al: GENETIC VARIABILITY OF Verbascum                                                                                 249  Figure 1. Distance-based cluster analyses between four mullein populations, from uncontaminated soils (NM1 and NM2) and from Cu and Zn contaminated soils (M1 and M2).  DISCUSSION Unstructured, disturbed soils resulting from industrial and mining activities present an open space which can be colonized by pioneer species (LEHMANN and REBELE, 2004). Such soils are contaminated with metals, have poor nutrient availability and disturbed microflora (KE et al., 2007). Under these unfavourable conditions, selective pressure can lead to favouring metal tolerant genotypes (LIU et al., 2004). Here we investigated genetic variability of 4 mullein populations, 2 from metal contaminated and 2 from uncontaminated sites. Genetic distances based on the coverage of 55 loci, varied in the range of 0.14 distance units. Similarly, DLUGOSCH and PARKER (2007) have determined genetic relatedness among V. thapsus populations by AFLP markers and presented the variation of genetic distances between populations mostly below 0.1 distance units.  In our work, cluster analysis clearly distinguished four populations, revealing higher genomic similarity between populations from metal uncontaminated, in comparison to populations from metal contaminated areas (Figure 1). DENG et al. (2007) have investigated the effect of heavy metal pollution on genetic diversity of Sedum alfredii populations by RAPDs and found that populations clustered according to their metal accumulation and tolerance capabilities. Our data are in favour of the effect of metal contamination as a strong selective pressure favouring tolerant genotypes and leading to differentiation between populations. Therefore these populations are promising model system for further investigations of plant adaptive mechanisms to metal tolerance.  ACKNOWLEDGEMENT This research was supported by III43010 project funded by the Ministry of Education and Science, Republic of Serbia.                                                              Received December 09th, 2014                                                        Accepted February  25th, 2015    250                                                                                                             GENETIKA, Vol. 47, No1, 245-251, 2015 REFERENCES DENG, J., B. LIAO, M. YE, D. DONGMEI, L. CHONGYU, S. WENSHENG (2007): The effects of heavy metal pollution on genetic diversity in zinc/cadmium hyperaccumulator Sedum alfredii populations. Plant Soil., 297:83-92.  DLUGOSCH, K.M., I.M. PARKER (2007): Molecular and quantitative trait variation across the native range of  the invasive species  Hypericum canariense : evidence for ancient patterns of colonization via pre adaptation? Mol Ecol., 16:4269–4283. FELSENSTEIN, J. (1985): Confidence limits on phylogenies: an approach using the bootstrap. Evolution., 39:783–793. HAHN, V., S. WIECKHORST  (2010):  Mapping and tagging of simply inherited traits. In: Hu J, Seiler G, Kole C, editors. Genetics, Genomics and Breeding of Sunflower, USA: Science Publishers Enfield, pp. 111-133. HAMMER Ø, D.A.T. HARPER, P.D. RYAN (2001): PAST: Paleontological Statistics Software Package for Education and Data Analysis. Palaeontol Electron., 4:9. JACCARD, P. (1901) : Étude comparative de la distribution florale dans une portion des Alpes et des Jura. Bulletin de la Société Vaudoise des Sciences Naturelles, 37:547–579. JOVANOVIC, LJ., F. MORINA, B. KUKAVICA, S VELJOVIC-JOVANOVIC (2007): High antioxidative capacity of Verbascum thapsus L. from a metal-contaminated area is induced upon treatment with Zn. In: Zhu Y, Lepp N, Naidu R, editors. Biogeochemistry of Trace Elements in the Environment: Environmental Protection, Remediation, and Human Health. Proceedings of the Ninth ICOBTE. Beijing, China: Tsinghua University Press, 184-185. KE, W., Z.T. XIONG, S. CHEN, J. CHEN (2007): Effects of copper and mineral nutrition on growth, copper accumulation and mineral element uptake in two Rumex japonicus populations from a copper mine and an uncontaminated field sites. Environ. Exp. Bot., 59:59-67. KUMSCHICK, S., A.R. HUFBAUER, C. ALBA, D.M. BLUMENTHAL (2013): Evolution of fast-growing and more resistant phenotypes in introduced common mullein (Verbascum thapsus). J Ecol., 101:378–387. LEHMANN, C., F. REBELE (2004): Evaluation of heavy metal tolerance in Calamagrostis epigejos and Elymus repens revealed copper tolerance in a copper smelter population of C. epigejos. Environ. Exp. Bot., 51:199-213. LIU, J., Z. XIONG, T. LI, H. HUANG (2004): Bioaccumulation and ecophysiological responses to copper stress in two populations of Rumex dentatus L. from Cu contaminated and non-contaminated sites. Environ. Exp. Bot., 52:43-51. MORINA, F., LJ. JOVANOVIĆ, B. KUKAVICA, S. VELJOVIĆ-JOVANOVIĆ (2008): Peroxidase, phenolics and antioxidative capacity of common mullein (Verbascum Thapsus L.) grown in zinc excess. Arch. Biol. Sci., 60:687-695. MORINA, F., LJ. JOVANOVIĆ, M. MOJOVIĆ, M. VIDOVIĆ, D. PANKOVIĆ, S. VELJOVIĆ-JOVANOVIĆ (2010): Zinc-induced oxidative stress in Verbascum thapsus is caused by an accumulation of reactive oxygen species and quinhydrone in the cell wall. Physiol. Plant., 140:209-224. NEJSUM, P., E.D.J.R. PARKER, J. FRYDENBERG, A. ROEPSTORFF, J. BOES, HAQUE R, ASTRUP I, PRAG J, SORENSEN UBS (2005): Ascariasis is a zoonosis in Denmark.  J Clin. Microbiol., 3:1142-1148. PANKOVIĆ, D., N. RADOVANOVIĆ, S. JOCIĆ, Z. SATOVIC,  D. ŠKORIĆ (2007): Development of co-dominant amplified polymorphic sequence markers for resistance to sunflower downy mildew race 730.  Plant Breeding, 4:440-444. PARKER, I.M., J. RODRIGUEZ, M.E. LOIK (2003): An evolutionary approach to understanding the biology of invasions: local adaptation and general-purpose genotypes in the weed Verbascum thapsus. Conserv. Biol., 17:59–72. SAFTIĆ-PANKOVIĆ, D., J. ATLAGIĆ, T. MILJANOVIĆ, N. RADOVANOVIĆ (2005): Morphological and molecular variability of Helianthus giganteus L. and Helianthus maximiliani Sch. Species. Genetika, 2:121-130. TANG, S., J.K. YU, M.B. SLABAUGH, D.K. SHINTANI, S.J. KNAPP (2002): Simple sequence repeat map of the sunflower genome. Theor. Appl. Genet., 105:1124-1136.  G. DANILOVIC et al: GENETIC VARIABILITY OF Verbascum                                                                                 251  GENETIČKA VARIJABILNOST POPULACIJA IZ RODA Verbascum  SA LOKALITETA ZAGAĐENIH I NEZAGAĐENIH METALIMA  Gordana DANILOVIĆ1, Filis MORINA2 Zlatko SATOVIC3, Ljiljana PROKIĆ4,  Dejana PANKOVIĆ1*  1 Fakultet zaštite životne sredine, Univerzitet Educons, Sremska Kamenica 2Institut za biološka istraživanja „Siniša Stanković“, Univerzitet u Beogradu, Beograd 3Agronomski fakultet, Univerzitet u Zagrebu, Zagreb, Hrvatska 4Poljoprivredni fakultet, Univerzitet u Beogradu, Beograd, Srbija  Izvod Divizma (Verbascum) je široko rasprostranjena i može da raste u različitim uslovima životne sredine. U ovom radu je ispitana genetička varijabilnost na potomstvu populacija biljaka divizme koje su sakupljene sa četiri lokaliteta, dva zagađena metalima i dva nezagađena. Rezultati dobijeni sa RAPD i SSR markerima, kao i UPGMA analizom ukazuju na veću genetičku sličnost  između populacija sa nezagađenih, u odnosu na populacije sa zagađenih lokaliteta. Genetička diferencijacija između ispitivanih populacija ukazuje da ove populacije predstavljaju pogodan model sistem za dalja ispitivanja mehanizama adaptacije biljaka na povećane sadržaje metala.                                              Primljeno 09. XII. 2014.                                                                                                                                                         Odobreno 25 II. 2015.  

Genetic variability of verbascum populations from metal polluted and unpolluted sites

Mullein (Verbascum) plants have extensive distribution and can grow in
   variable environmental conditions. Seed was collected from mullein plants
   grown at 4 locations, two metals contaminated and two metal uncontaminated
   areas. Genetic variability of progeny was examined. Populations collected
   from unpolluted areas were genetically more similar than those collected from
   polluted areas as revealed by RAPD and SSR markers and UPGMA analysis. The
   results indicate that there is genetic differentiation between examined
   populations and therefore they represent suitable material for further
   investigation of plant adaptation mechanisms to increased metal content.</jats:p

Genetic variability of verbascum populations from metal polluted and unpolluted sites

Abstract

Similar works

Full text

Available Versions

Directory of Open Access Journals

AgroSpace

Crossref