The discovery of auxinic herbicides (e.g., 2,4-D, Dicamba, Picloram) for selective control of broad-leaf weeds in cereal crops revolutionized modern agriculture. These herbicides are inexpensive and do not generally have prolonged residual activity in soil. Although cultivated species of Brassicaceae (e.g., radish and other vegetables) are susceptible to auxinic herbicides, some biotypes of wild mustard (Sinapis arvensis, 2n = 18) were found to be highly resistant to Picloram and Dicamba. Inter-generic hybrids between wild mustard and radish (Raphanus sativus, 2n = 18) were produced by traditional breeding coupled with&nbsp;in vitro&nbsp;embryo rescue/ovule culture. To increase frequency of embryo regeneration and hybrid plant production, several hundred reciprocal crosses were performed between these species. Upon altering cultural conditions and media composition, a high frequency of embryo regeneration and hybrid plant establishment was achieved. A protocol was also optimized for&nbsp;in vitro&nbsp;clonal multiplication of inter-generic hybrids produced by embryo rescue. To evaluate transfer of auxinic herbicide resistance from wild mustard into hybrid plants, several screening tests (involving&nbsp;in vitro, molecular-based as well as whole plant-based tests) were performed. Results indicated that hybrids of&nbsp;R. sativus&nbsp;x&nbsp;S. arevensis&nbsp;were resistant to auxinic herbicides suggesting, that, the resistance trait was transferred to these hybrids from the wild mustard. This research for the first time demonstrates the possibility of transfer of auxinic herbicide resistance from wild mustard to radish

Hall, J Christopher

Mithila, J

English

The discovery of auxinic herbicides (e.g., 2,4-D, Dicamba, Picloram) for selective control of broad-leaf weeds in cereal crops revolutionized modern agriculture. These herbicides are inexpensive and do not generally have prolonged residual activity in soil. Although cultivated species of Brassicaceae (e.g., radish and other vegetables) are susceptible to auxinic herbicides, some biotypes of wild mustard (Sinapis arvensis, 2n = 18) were found to be highly resistant to Picloram and Dicamba. Inter-generic hybrids between wild mustard and radish (Raphanus sativus, 2n = 18) were produced by traditional breeding coupled with in vitro embryo rescue/ovule culture. To increase frequency of embryo regeneration and hybrid plant production, several hundred reciprocal crosses were performed between these species. Upon altering cultural conditions and media composition, a high frequency of embryo regeneration and hybrid plant establishment was achieved. A protocol was also optimized for in vitro clonal multiplication of inter-generic hybrids produced by embryo rescue. To evaluate transfer of auxinic herbicide resistance from wild mustard into hybrid plants, several screening tests (involving in vitro, molecular-based as well as whole plant-based tests) were performed. Results indicated that hybrids of R. sativus x S. arevensis were resistant to auxinic herbicides suggesting, that, the resistance trait was transferred to these hybrids from the wild mustard. This research for the first time demonstrates the possibility of transfer of auxinic herbicide resistance from wild mustard to radish

J Mithila

J Christopher Hall

Directory of Open Access Journals

INTRODUCTIONAuxinic herbicides (e.g., 2,4-D, Dicamba andPicloram) were the first synthetic herbicides discovered andhave been in use for more than seven decades. These havebeen a favorite choice among growers worldwide as theyselectively control broad-leaf weeds in cereal crops. Owingto this, they are not recommended for use in commerciallyimportant dicot crops such as canola, radish or soybean.Biotypes of some broad-leaf weeds such as kochia, yellowStar Thistle, and wild mustard, have evolved resistance toauxinic herbicides due to selection pressure. Auxinicherbicide-resistant (R) wild mustard biotypes were foundto be highly resistant to Picloram and Dicamba (104-fold)(Heap and Morrison, 1992). Genetic analysis of wild mustardauxinic herbicide resistance suggests that the resistance isdetermined by a single dominant gene (Jugulam et al, 2005;Jasienuik et al, 1995). Further, we recently reportedidentification of morphological and molecular markers linkedTransfer of auxinic herbicide resistance from wild mustard (Sinapis arvensis) intoradish (Raphanus sativus) through embryo rescueJ. Mithila and J. Christopher Hall1Kansas State University, Manhattan KS, USA, 66506E-mail : mithila@k-state.eduABSTRACTThe discovery of auxinic herbicides (e.g., 2,4-D, Dicamba, Picloram) for selective control of broad-leaf weeds incereal crops revolutionized modern agriculture. These herbicides are inexpensive and do not generally have prolongedresidual activity in soil. Although cultivated species of Brassicaceae (e.g., radish and other vegetables) are susceptibleto auxinic herbicides, some biotypes of wild mustard (Sinapis arvensis, 2n = 18) were found to be highly resistant toPicloram and Dicamba.  Inter-generic hybrids between wild mustard and radish (Raphanus sativus, 2n = 18) wereproduced by traditional breeding coupled with in vitro embryo rescue/ovule culture. To increase frequency of embryoregeneration and hybrid plant production, several hundred reciprocal crosses were performed between these species.Upon altering cultural conditions and media composition, a high frequency of embryo regeneration and hybrid plantestablishment was achieved. A protocol was also optimized for in vitro clonal multiplication of inter-generic hybridsproduced by embryo rescue. To evaluate transfer of auxinic herbicide resistance from wild mustard into hybrid plants,several screening tests (involving in vitro, molecular-based as well as whole plant-based tests) were performed.Results indicated that hybrids of R. sativus x S. arevensis were resistant to auxinic herbicides suggesting, that, theresistance trait was transferred to these hybrids from the wild mustard. This research for the first time demonstratesthe possibility of transfer of auxinic herbicide resistance from wild mustard to radish.Key words:  Auxinic herbicide,embryo rescue, radish, resistance,  transfer, wild mustard to auxinic herbicide resistance in wild mustard (Mithilaet al, 2012).The family Brassicaceae consists of a number ofeconomically important species, including oilseed canola, andvegetable crops such as cabbage, cauliflower, radish andbroccoli. This family also comprises an excellent reservoirof genes for many economically important traits and isextremely conducive to gene transfer techniques. Radish isan important vegetable crop grown across the globe.Transfer of agronomically desirable traits among Brassicamembers, for example, between wild mustard and canola,has been previously reported (Bing et al, 1995; Inomata,1988; Momotaz et al, 1998). However, to our knowledge,there are no reports describing transfer of agronomicallyimportant traits from wild mustard to radish. In this research,we tested the feasibility of transfer of auxinic herbicideresistance from wild mustard to radish following bothtraditional breeding and embryo rescue methods.1Department of Environmental Biology, University of Guelph, Guelph, Ontario, Canada, N1G 2W1J. Hortl. Sci.Vol. 7(1):29-33, 201230Mithila and Christopher HallMATERIAL AND METHODSRaising wild mustard and radish parental plants toproduce hybridsAuxinic herbicide -R wild mustard and -susceptible(S) radish plants were raised from seed.   Seeds were sownin 6" plastic pots containing ‘Promix’, and placed in a growthchamber with 16-h photoperiod and 22/15oC day/nighttemperature.  Light intensity and relative humidity weremaintained at 350µmol.s-1m-2 and 65-75%, respectively.Each pot contained one plant and the plants were irrigatedwhen required and fertilized weekly with 20:20:20 (N:P:K).To confirm resistance to Dicamba, wild mustard plants weretreated with Dicamba (Banvel, BASF, USA) at 200g ae/ haat three- to four-leaf stage of development (procedure forDicamba application is described later; we used Dicambain all experiments in this research, because it is a widelyused auxinic herbicide in agriculture for control of broad-leaf weeds). All the plants survived Dicamba treatment andwere used for further experimentation.To produce hybrid plants between auxinic herbicide– R wild mustard and radish, reciprocal crosses wereperformed between these plants following the proceduresdescribed by Jugulam et al (2005) for wild mustard.Intergeneric hybrids failed to develop in vivo, as, the siliques(narrow, elongated seed-capsule) did not grow completely,i.e., it ceased growth before reaching maturity. Therefore,an in vitro method was sought for completion of embryomaturation and plantlet formation. To achieve plantletregeneration via embryo rescue, we followed two strategies.In the first approach, siliques from crosses betweenDicamba-R wild mustard and –S radish were harvestedafter ∼10-12 days of pollination. These siliques weredisinfested with 70% ethanol for 1–2 min, followed by 20%commercial bleach (sodium hypochlorite, 5.25%) containingthree to four drops of Tween-20 for 15–20 min, andsubsequently, rinsed four to five times with sterile deionizedwater. Embryos/ ovules from the siliques were excisedaseptically with forceps and scalpel for culture on Petri dishcontaining 15 ml of one of the following two media: (A) MS(Murashige and Skoog, 1962) salts with Gamborg vitamins,sucrose (3%), 500 mg/l casein hydrolysate, or, (B) MS saltswith Gamborg vitamins, sucrose (3%), 0.5 mg/l NAA, 2.5mg/l Kinetin; pH of the media was adjusted to 5.8, and 8g ofagar was added prior to autoclaving at 121oC for 20 min. Inthe second strategy, immature siliques were harvested 3-5days post-pollination and surface-sterilized (as describedabove), followed by aseptic culture of the entire silique onmedium A or B. The siliques were allowed to grow on themedia for ∼ 2 weeks, after which ovules were excised outfrom the siliques and cultured in a Petri dish containing freshmedium (A or B) for ovule maturation and regeneration intoplantlets. All cultures were incubated in a growth room at24oC under light (16-h photoperiod; 50µmol s-1 m-2) providedby cool, white fluorescent lamps (Philips Canada,Scarborough, ON).After four weeks of embryo/ovule culture,regenerated hybrid plantlets were transferred individuallyto ‘Magenta’ boxes (300 ml plastic vessels, Magenta Corp.,Chicago IL, USA) containing medium (C): MS salts withGamborg vitamins and sucrose (1.5%); pH of medium Cwas also adjusted to 5.8, and 8g of agar was added beforeautoclaving at 121oC for 20 min. At four weeks upon transferto medium C, the hybrid plants produced well-developedroot and shoot system. At this stage, these hybrid plantswere clonally multiplied by sub-culturing nodal segments inMagenta boxes containing medium C. In vitro hybrid plantswith well-developed roots and shoots were transferred tosoil (‘Promix’) and grown in a growth room under the sameconditions as described, earlier for wild mustard and radishparental plants. Assessment of transfer of auxinic herbicide resistanceinto hybrids(i) In vitro assay: Previously, Mithila and Hall (2005)developed an in vitro assay to assess sensitivity of plants(explants) to auxinic herbicides. We used this protocol forinitial screening to identify hybrid plants possessing auxinicherbicide resistance. For this assay, about 50-60 seeds ofwild mustard auxinic herbicide-R and –S radish weresurface-sterilized with 80% alcohol for 2-3 minutes and, then,treated with 30% bleach containing a drop of Tween-20,for 12-15 min.  Subsequently, the seeds were rinsed 4-5times with sterile distilled water.  Sterilized seeds werecultured aseptically on medium C (described above) inMagenta boxes.  Cultures were incubated in a growth room(under the same conditions as described above).  After 6-7weeks, stem segments of about 1 cm were excisedaseptically using a scalpel from the seedlings of auxinicherbicide-R wild mustard and –S radish, as well as fromclonally propagated hybrid plants, and cultured on medium(D) containing MS salts with Gamborg vitamins, sucrose(3%) and various doses of Dicamba or Picloram (0, 1, 5 or10M); pH of medium D was adjusted to 5.8, and 8g of agarwas added before autoclaving at 121oC for 20 min. At 3-4weeks from initial culture, response of stem segments toDicamba was recorded.J. Hortl. Sci.Vol. 7(1):29-33, 201231(ii) Molecular assay: Recently, we developed a geneticmap describing AFLP (amplified fragment lengthpolymorphism) markers closely linked to auxinic herbicideresistance in wild mustard (Mithila et al, 2012). The twoclosest flanking regions on either side of R locus werelocated at a distance of 1.58 and –6.35 map units. TheseDNA markers were sequenced. To further assess transferof auxinic herbicide resistance from wild mustard to radish,primers from the sequence of the closest marker (1.58 mapunits) were designed in the present stud (Forward primer:GGCCGCGAGACATTGGTGA and reverse primer:TCTCTCGTGACCCTTTACAATTAG) and synthesized.Genomic DNA was extracted from leaf tissue of hybridplants as well as auxinic herbicide-R, -S wild mustard(auxinic herbicide-S wild mustard DNA was used as anegative control) and –S radish using DNeasy® Plant Mini(QIAGEN, Mississauga, ON, Canada) followingmanufacturer’s protocol.  Using the above-describedprimers, a PCR (polymerase chain reaction)-based assaywas performed for detecting presence or absence of thePCR product (∼ 220 bp length) that corresponded to theclosest AFLP marker. The following PCR conditions wereused: initial denaturation at 94oC for 3 min, followedby 30 cycles at 94oC for 30 seconds, 56oC for 30 secondsand 72oC for 45 seconds, with a final extension at 72oCfor 7 min.(iii) Whole-plant based assay: Whole-plant screening wasperformed to validate transfer of auxinic herbicide resistancefrom wild mustard into hybrid plants. In vitro grown hybridplants were established in soil. Auxinic herbicide-R wildmustard and –S radish plants were raised in a growthchamber as described earlier. Seedlings were treated withDicamba (200g ae ha-1) at three-to-four leaf stage ofdevelopment using a motorized hood-sprayer.  The sprayerwas equipped with a flat-fan nozzle (8002 E) and calibratedto deliver 200 l/ha at 276 kPa.  One and two weeks aftertreatment, the seedlings were visually rated for injury. Hybridplants were classified as R or S by comparing the injuryresponse with that in wild mustard auxinic herbicide-R and–S radish seedling response.  Susceptibility of the plants toDicamba was assessed based on symptoms of epinasty(downward curling of leaf and stem tissue) followed bydeath, whereas, R plants should show little or no responseto Dicamba.RESULTS AND DISCUSSIONInter-generic hybrids of radish and wild mustard failedto develop in vivo as the siliques were not able to growcompletely, and ceased to develop ahead of maturity. Amongthe two strategies followed to produce inter-generic hybridsin vitro, the second strategy yielded more number ofregenerated embryos than in the first approach (Table 1).There was no significant difference in the number of hybridsproduced when embryos were cultured on medium A or B(Table 1). These inter-generic hybrids exhibited severalmorphological traits of both parents (e.g., leaf shape, stem,plant height and flower colour, Fig.1). Clones of the hybridswere also successfully established in vitro by nodal cuttings.To our knowledge, this is the first report describingproduction of hybrids between wild mustard and radish viaembryo rescue.Sensitivity to auxinic herbicides results in excessiveroot growth in plant cultures in vitro (Mithila and Hall, 2005).In this study, after 3-4 weeks of initial culture of stemsegments, excessive root formation was observed inDicmaba-S radish in response to 1, 5 or 10µM Dicamba orPicloram in the medium. Conversely, wild mustard Rsegments did not show root formation even at 10µMDicamba or Picloram (Fig. 2). More importantly, stemsegments for all hybrids produced via embryo rescueresponded similarly to R wild mustard when treated withDicamba or Picloram (Fig. 2). These results suggest thatDA BFig 1. Hybrids produced by crossing auxinic herbicide-S R.-sativusand -R S. arvensis: A and B represent R. sativus and S. arvensisplants, respectively. C and D are the inter-generic hybrids producedby crossing R. sativus and S. arvensis and following embryo rescuetechnique  (note the hybrid exhibiting characteristics intermediatebetween R. sativus and S. arvensis)Intergeneric transfer of herbicide resistance to radish using embryo rescueJ. Hortl. Sci.Vol. 7(1):29-33, 2012C32all the hybrids derived via embryo rescue from crosses (bothdirect and reciprocal) between radish (S) x wild mustard(R) were found not sensitive to Dicamba or Picloram.Therefore, it appears that the R trait was transferred to thehybrids from R biotypes of the wild mustard. In addition,PCR results of molecular-based assay also demonstratedpresence of a 220 bp fragment (representing the AFLPmarker closely-linked to auxinic herbicide resistance in wildmustard; Mithila et al, 2012) in all the hybrids, and inDicamba-R wild mustard; whereas, DNA of auxinicherbicide-S wild mustard and radish did not show thisfragment (Fig. 3). These results suggest that the DNAfragment containing auxinic herbicide-resistance from wildmustard was probably transferred to R hybrids. Results fromwhole-plant screening further confirmed Dicamba resistancein the hybrids (Fig. 4) since these displayed little or noepinasty, a response that was similar to that in R wild mustardplants; however, radish plants ceased to grow 2 weeks aftertreatment with Dicamba (Fig. 4).Fig 2.  Response to Dicamba (10µM) or Picloram (10µM) of stemsegments of auxinic herbicide-R S. arvensis, -S radish (R.-sativus)and their hybrids (R. sativus X S. arvensis)Fig 3. PCR product (∼ 220 bp) amplified by primers correspondingto a closet AFLP marker linked to Dicamba resistance in wildmustard (Mithila et al, 2012): Lane 1: 100 bp ladder; 2: reactionwithout a template; 3, 5: wild mustard auxinic herbicide-R; 4, 6:wild mustard-S biotype; 7: radish; 8, 9: inter-generic auxinicherbicide-R hybridsFig 4. A-C: Plants treated with Dicamba (200g ae/ha) 7 days aftertreatment. A and C illustrate dicamba- S radish and -R wildmustard, respectively; B represents the hybrid plant between radish(S) x wild mustard (R)Successful gene transfer from interspecific crossesusing conventional plant breeding techniques involves severalbarriers, including (but not limited) to pollen-stigmaincompatibility or sterility, embryo and endosperm imbalance,homologous chromosome pairing between the species, etc.In this research, we have demonstrated production ofhydrids between two diploid species of Brassicaceae, viz.,S. arvensis and R. sativus. Although both these speciesare diploid with 2n:18, genomes of these two species aredifferent (Mizusima,1980).  Success of interspecifichybridization among members of Brassicaceae depends ongenome compatibility as well as ploidy of the speciesTable 1. Hybrids produced by crossing auxinic herbicide-S R. sativus and -R S. arvensis: Frequency of embryo regeneration and hybridplant establishment upon direct and reciprocal crossing followed by in vitro culture and embryo rescueCross combination No. of buds No. of siliques No. of embryos No. of embryos No. of hybridspollinated cultured excised germinated obtainedStrategy I1. R. sativus x S. arvensis 100-150 - ∼ 70 (A or B) 2 22. S. arvensis x R. sativus 100-150 - ∼ 65 (A or B) 1 1Strategy II1. R. sativus x S. arvensis 150-200 ~ 125 ∼ 50 (A or B) 5 52. S. arvensis x R. sativus 150-200 ~ 110 ∼ 25 (A or B) 1 1A: MS salts + Gamborg vitamins (4.4. g/l) + 30 g sucrose/l + 500 mg/l casein hydrolysate (pH of the medium 5.8; agar 8 g/l)B: MS salts + Gamborg vitmains (4.4 g/l) + 30g sucrose/l + 0.5mg/l NAA + 2.5mg/lkinetin (pH of the medium 5.8; agar 8 g/l)Mithila and Christopher HallJ. Hortl. Sci.Vol. 7(1):29-33, 201233(Mizusima, 1950). Based on cytogenetic analyses byMizusima (1980), it appears that at least one chromosomeof S. arvensis can form a bivalent with R. sativus duringmeiosis.  Since all the hybrids produced via embry rescue inthis research were found R to auxinic herbicides, theDicamba-R gene residing on S. arvensis chromosome mayhave formed a bivalent with R. sativus, thereby transferringDicamba resistance into radish.In conclusion, in we have shown for the first time,possibility of production of Dicamba-R hybrids between R.sativus and S. arvensis. Further experiments are requiredto test the possibility of introgressing auxinic herbicideresistance from hybrids into radish by repeated backcross-breeding to develop radish varieties with desirable agronomictraits, along with auxinic herbicide resistance. This will allowselective removal of most broad-leaf weeds. Further,development of auxinic herbicide resistant radish followingtransfer of resistance trait from related species byintrogreesion breeding is a non-transgenic approach thus,allowing acceptance across the globe, including Europe.ACKNOWLEDGEMENTFinancial support to JCH from Natural Science andEngineering Research Council of Canada, and BASF, NC,USA through NSERC-CRD grant, is gratefullyacknowledged.REFERENCESBing, D.J., Downey, R.K. and Rakow, F.W, 1995, Anevaluation of the potential intergeneric gene transferbetween Brassica napus and Sinapis arvensis.Plant Breed., 114:481-484Heap. I.M. and Morrison. I.N. 1992, Resistance to auxin-type herbicides in wild mustard (Sinapis arvensis L.)populations in western Canada.  Annual Meeting ofWeed Science Society of America. Abstract # 32,p. 164Inomata, N.,1988. Intergeneric hybridization betweenBrassica napus and Sinapis arvensis and theircrossability. Eucarpia Cruciferae Newslett., 13:22-23Jasieniuk, M., Morrison, I.N. and Brule-Babel, A.L.1995.Inheritance of Dicamba resistance in wild mustard(Brassica kaber). Weed Sci., 43:192-195Jugulam, M., McLean, M.D. and Hall, J.C.2005. Inheritanceof Picloram and 2,4-D resistance in wild mustard(Brassica kaber). Weed Sci., 53:417-423Mithila, J. and Hall, J.C.2005. Comparison of ABP1 over-expressing Arabidopsis and under-expressingtobacco with an auxinic herbicide-resistant wildmustard (Brassica kaber) biotype.  Pl. Sci., 169:21-28Mithila, J. McLean, M.D., Chen, S. and Hall, J.C. 2012.Development of near-isogenic lines and identificationof markers linked to auxinic herbicide resistance inwild mustard (Sinapis arvensis). Pest Mgt. Sci.,68:548-556Mizushima, U. 1950 Karyogenetic studies of species andgenus hybrids in the tribe Brassiceae of Cruciferae.Tohoku J. Agril. Res., I:1-14Mizushima, U. 1980 Genome analysis in Brassica and alliedgenera. In: Tsunoda, T., Hinata, K. and Gomez-Campo, G. (eds), Brassica Crops and Wild Allies,Biology and Breeding, pp. 89-106, Japan ScientificSocieties Press, TokyoMomotaz, A., Kato, M. and Kakihara, F.1998. Productionof intergeneric hybrids between Brassica and Sinapisspecies by means of embryo rescue techniques.Euphytica, 103:123-130(MS Received 07 June 2012, Revised 28 June, 2012)Intergeneric transfer of herbicide resistance to radish using embryo rescueJ. Hortl. Sci.Vol. 7(1):29-33, 2012

Transfer of Auxinic Herbicide Resistance from Wild Mustard (Sinapis arvensis) into Radish (Raphanus sativus) through Embryo Rescue

Journal of Horticultural Sciences

https://jhs.iihr.res.in/index.php/jhs/article/download/384/251

Transfer of Auxinic Herbicide Resistance from Wild Mustard (Sinapis arvensis) into Radish (Raphanus sativus) through Embryo Rescue

Abstract

Similar works

Full text

Available Versions

Directory of Open Access Journals

Journal of Horticultural Sciences