Fu, Qihua

Jin, Lei

Lv, Qinfeng

Yan, Lixing

Zhu, Faming

Exeley Inc.

I M M U N O H E M A T O L O G Y, V O L U M E  2 1 , N U M B E R  1 , 2 0 0 5 25FcγRIIIb receptor is expressed primarily on neutrophils as threepolymorphic antigens (HNA-1a, HNA-1b, and HNA-1c) that areencoded by alleles FCGR3B*1, FCGR3B*2, and FCGR3B*3,respectively. These antigens play an important role in immuneneutropenia; their absence predisposes individuals who lack themto life-threatening infections. This study investigated the FCGR3Bgene frequencies in three ethnic Chinese populations:Han,She,andTajik. FCGR3B*1, FCGR3B*2, and FCGR3B*3 were genotyped byPCR using sequence specific primers (PCR-SSP). The resultsshowed the gene frequencies were 0.55 for FCGR3B*1 and 0.45 forFCGR3B*2 in 177 Han individuals,0.69 for FCGR3B*1 and 0.31 forFCGR3B*2 in 87 She individuals, and 0.35 for FCGR3B*1 and 0.65for FCGR3B*2 in 99 Tajik individuals, respectively. The FCGR3Bnullgenotype was not found, but the FCGR3B*3 allele was identified inonly three individuals in the Tajik population. DNA clone andsequencing confirmed that these individuals had the C⇒Amutation at position 266 on exon 3. This study found that the genefrequencies in Han and She ethnic groups were similar to thosepreviously reported in the Asian population, but the FCGR3B allelefrequencies in the Tajik population were more similar to that ofCaucasians. Immunohematology 2005;21:25–28.Key Words: FCGR3B, gene frequency, Chinesepopulation, PCR-SSP, Fc receptorFcγRIII is a low-affinity Fc gamma receptor onleukocytes, existing as two isoforms, FcγRIIIa andFcγRIIIb.1 FcγRIIIa is expressed on natural killer cells,monocytes, and macrophages. FcγRIIIb is expressedprimarily on neutrophils and as three polymorphicantigens (human neutrophil antigen, HNA-1a [formerlyNA1]), HNA-1b (formerly NA2), and HNA-1c (formerlySH, NA3), which are encoded by alleles FCGR3B*1,FCGR3B*2, and FCGR3B*3, respectively.2 FCGR3B*1and FCGR3B*2 differ at five nucleotide (nt) positions(141G⇒C,147C⇒T,227A⇒G,277G⇒A,and 349G⇒A)that encode four amino acid changes.1,2 FCGR3B*3 isidentical to FCGR3B*2 except for a single base change(266C⇒A) that encodes amino acid Ala78Asp.3Polymorphisms of neutrophil antigens areimportant clinically because of their role in antibody-mediated immune neutropenia. In addition, alleles ofFCGR3B distinguish certain racial and ethnicpopulations. In French, German, American Caucasian,and African Black populations, FCGR3B*2 is the mostprevalent FCGR3B allele,4,5,6 whereas in certainChinese and Japanese populations, FCGR3B*1 is moreprevalent.7,8 FCGR3B*3 occurs in 0.05 percent ofCaucasians,3 but has not been reported in Asians.7,8Rarely, individuals lack FcγRIIIb neutrophil antigens(NAnull), predisposing them to life-threateninginfections. Also, several low-prevalence FCGR3Bvariant alleles that carry a single-base substitution ofone of the five polymorphic sites on FCGR3B havebeen identified in certain Caucasian and Blackpopulations.5,9Frequencies of FCGR3B genes and of seven FCGR3variants have been described in Chinese individualsfrom Zhejiang Province.8 China’s population is largeand genetically heterogeneous. Most indigenousChinese are ethnically Han (92%). The remaining 8percent of indigenous Chinese represent 55 ethnicminorities. Ethnic She (630,000 individuals) reside inFujian, Zhejiang, and Jiangxi Provinces. Ethnic Tajik(33,000 individuals) reside in Xinjiang Province. Wedescribe the frequencies of FCGR3B alleles and theresults of screening for FcγRIII variants among Han,She, and Tajik populations.Materials and MethodsSubjectsPeripheral blood samples were collected fromvolunteer blood donors after obtaining informedconsent. We interviewed subjects to categorize themas Han (Zhejiang Province), She (Zhejiang Province), orTajik (Xinjiang Province).DNA extraction and genotyping FCGR3BWe extracted genomic DNA from whole blood,using a QIAamp Blood Kit (Qiagen GmbH,Hilden,Germany). Allele-specific DNA amplificationwas performed according to the protocol of Bux etal.3,10 Primer sequences are listed in Table 1.3Genotypes were assigned by the presence or absenceFCGR3B polymorphism in threeethnic Chinese populationsL.YAN, F. ZHU, L. JIN, Q. LV,AND Q. FU26 I M M U N O H E M A T O L O G Y, V O L U M E  2 1 , N U M B E R  1 , 2 0 0 5L.YAN ET AL.of an electrophoretic band in 2% agarose gel stainedwith ethidium bromide and visualized by ultravioletlight (GeneGenius, Syngene, UK).Sequencing FCGR3A and FCGR3BWe performed DNA sequencing on samples from12 individuals from the Tajik population with threedifferent FCGR3B forms. DNA fragments encom-passing the full exon 3 coding region were amplifiedusing primers designed by our laboratory (Table 1),which can amplify both FCGR3A and FCGR3B genes.The PCR reaction mixture contained 50 to 100 nggenomic DNA, 2.5 µL of dNTP (200 µmol/L each),2.5 µL 10X PCR buffer (100 mmol/L Tris-HCl, pH 8.3,and 500 mmol/L KCl), 2.0 mmol/L MgCl2, 0.5 µmol/Lof forward and reverse primers, and 1.0 U Taq DNApolymerase (Roche company) in a final volume of 25 µL. PCR amplification was performed with initialdenaturing at 95°C for 5 minutes followed by 30 cyclesof 30 seconds at 95°C, 30 seconds at 60°C, and 30seconds at 72°C, plus a final extension at 72°C for 10minutes. DNA amplified fragments were cloned usingTOPO cloning sequencing kits (Invitrogen Co.,Carlsbad,CA) according to manufacturer’s instructions.Positive clones according to blue and/or whiteselection were cultured in LB medium. Plasmid DNAwas extracted by using a plasmid DNA purification kit(Shanghai Bocai, China). DNA sequences weredetermined by amplified primers, using cyclesequencing kits (BigDye Terminator, AppliedBiosystems, Foster City, CA) and a Genetic Analyzer(ABI Prism 377, Applied Biosystems), according to themanufacturer’s instructions.Calculation of allele frequencies and statisticalanalysisAllele frequencies were calculated using theformula of Steffensen et al.6 Briefly, FCGR3B*1 andFCGR3B*2 were treated as two existing alleles at thesame locus. Based on this assumption, the frequencieswere calculated independently for FCGR3B*3 bycounting the number of each allele and calculating thepercentage. FCGR3B*3 frequency was calculated asone-half of the percentage of allele-positive individuals.We used chi-squared analyses to test for Hardy-Weinberg equilibrium for FCGR3B genes. A p < 0.05was considered to be statistically significant.ResultsAllele-specific DNA amplificationAmong the 172 Hans, 87 (50.6%) genotyped asFCGR3B*1+,*2+,*3–; 34 (19.8%) genotyped asFCGR3B*1–,*2+,*3–; and 51 (29.6%) genotyped asFCGR3B*1+,*2–,*3– (Table 2). Allele frequencieswere 0.55 for FCGR3B*1, 0.45 for FCGR3B*2, and0.00 for FCGR3B*3 (Table 3). Among the 87 Shes, 36(41.4%) individuals genotyped as FCGR3B*1+,*2+,*3–; 9 (10.3%) genotyped as FCGR3B*1–,*2+,*3–; and42 (48.3%) genotyped as FCGR3B*1+,*2–,*3–. Allelefrequencies were 0.69 for FCGR3B*1, 0.31 forFCGR3B*2, and 0.00 for FCGR3B*3. Among the 99Tajiks, 48 (48.5%) genotyped as FCGR3B*1+,*2+,*3–;38 (38.4%) genotyped as FCGR3B*1-,*2+,*3–; 10(10.1%) genotyped as FCGR3B*1+,*2–,*3–; 1 (1%)individual genotyped as FCGR3B*1+,*2+,*3+; and 2(2%) individuals genotyped as FCGR3B*1–,*2+,*3+.Table 1. Primers for PCR-SSP and DNA sequencingName Primer sequenceFCGR3B*1 sense 5´cag tgg ttt cac aat gtg aa3´FCGR3B*1 antisense 5´atg gac ttc tag ctg cac 3´FCGR3B*2 sense 5´caa tgg tac agc gtg ctt 3´FCGR3B*2 antisense 5´atg gac ttc tag ctg cac 3´FCGR3B*3 sense 5´aag atc tcc caa agg ctg tg 3´FCGR3B*3 antisense 5´tct gtc gtt gac tgt gtc at 3´Exon 3 forward 5´tgagctcattctggctttga3´Exon 3 reverse 5´tcaggaccctttgtttcacc3´Table 2. Genotype frequencies observed in the Han, She, and TajikpopulationsHan She TajikGenotype n % n % n %FCGR3B*1+,*2+,*3– 87 50.6 36 41.4 48 48.5FCGR3B*1–,*2+,*3– 34 19.8 9 10.3 38 38.4FCGR3B*1+,*2–,*3– 51 29.6 42 48.3 10 10.1FCGR3B*1–,*2–,*3– 0 0.0 0 0.0 0 0.0FCGR3B*1+,*2+,*3+ 0 0.0 0 0.0 1 1.0FCGR3B*1–,*2+,*3+ 0 0.0 0 0.0 2 2.0FCGR3B*1+,*2–,*3+ 0 0.0 0 0.0 0 0.0FCGR3B*1–,*2–,*3+ 0 0.0 0 0.0 0 0.0Table 3. FCGR3B allele frequencies in different populationsPopulation n FCGR3B*1 FCGR3B*2 FCGR3B*3Han(Zhejiang) 172 0.55 0.45 0.00She minority 87 0.69 0.31 0.00Tajik minority 99 0.348 0.652 0.015Japanese7 400 0.622 0.378 0.00Danish6 200 0.365 0.635 0.030Ugandan5 43 0.395 0.558 0.174Northern German5 260 0.373 0.627 0.025I M M U N O H E M A T O L O G Y, V O L U M E  2 1 , N U M B E R  1 , 2 0 0 5 27FCGR3B polymorphism in Chinese populationsAllele frequencies were 0.348 forFCGR3B*1, 0.652 for FCGR3B*2, and0.015 for FCGR3B*3. Differences betweenFCGR3B*1, FCGR3B*2, and FCGR3B*3frequencies among Hans, Shes, and Tajikswere significant (p < 0.001). We did notfind the FCGR3B*1–,*2-,*3– (FCGR3Bnull)genotype among the 358 samples tested.Three Tajik individuals expressed theFCGR3B*3 allele. Table 3 also listspreviously published allele frequencies incertain other populations.FCGR3 sequencingDNA cloning and sequencing confirmed the resultsof PCR-SSP analysis by showing that three FCGR3B*3positive samples had a C⇒A mutation at position 266on exon 3. We sequenced 76 clones of exon 3 ofFCGR3 from 12 Tajik subjects (Table 4). We identifiedthree individuals (7 clones) as having FCGR3B*2variants (141C, 147T, 227G, 266C, 277G, 349A), twoindividuals (2 clones) as having FCGR3A variants(141G, 147C, 227G, 266C, 277A, 349A), and oneindividual (1 clone) as having FCGR3B*2 variant(141G, 147T, 227G, 266C, 277A, 349A). Each variantdemonstrated either a single base substitution of one ofthe six polymorphic sites of the FCGR3 gene or a newcombination of nucleotides at the correspondingposition.DiscussionOur results confirm that FCGR3B*1 is moreprevalent than FCGR3B*2 among Chinese Hans andShes, as reported previously.7,8 We also found thatFCGR3B allele frequencies in the Tajik population werevery similar to those of Caucasians.5,6 We identifiedthree Tajik individuals with the FCGR3B*3 allele,which is the first time this allele has been identified inindigenous Asians. We did not find FCGR3B*3 in ourHan or She populations, which was consistent withprevious observations in other Asian populations. Wealso did not find the FCGR3Bnull genotype in any of thethree Chinese populations tested, but larger scaletesting is required to ascertain that it is totally absent inthe Chinese population.8Several FCGR3B variants have been described inAfrican Blacks and American Caucasians.9 Our findingof three new FCGR3B variants demonstrates that suchvariant genes also exist in Chinese populations. It isnot known whether these variants reflect somaticmutations or multiple gene loci. Also unknown is whatimpact mutations resulting in variant genes have on thefunction of FCGR3B gene-encoded neutrophil antigensor their corresponding Fc gamma receptors.References1. Qiu WQ, de Bruin D, Brownstein BH, et al.Organization of the human and mouse low-affinityFc gamma R genes: duplication and recombi-nation. Science 1990;248:732-5.2. Bux J. Nomenclature of granulocyte alloantigens.Transfusion 1999;39:662-3.3. Bux J, Stein EL, Bierling P, et al. Characterization ofa new alloantigen (SH) on the human neutrophilFc gamma receptor IIIb. Blood 1997;89(3):1027-34.4. Kissel K, Hofmann C, Gittinger FS, et al. HNA-1a,HNA-1b, HNA-1c (NA1, NA2, SH) frequencies inAfrican and American Blacks and in Chinese.Tissue Antigens 2000;56:143-8.5. Flesh BK, Doose S, Siebert R, et al. FCGR3 variantsand expression of human neutrophil antigen-1a,-1b, -1c in the population of northern Germanyand Uganda.Transfusion 2002;42:469-75.6. Steffensen R, Gulen T, Varming K, et al. FcγRIIIBpolymorphism:evidence that NA1/NA2 and SH arelocated in two closely linked loci and that the SHallele is linked to the NA1 allele in the Danishpopulation.Transfusion 1999;39:593-8.7. Fujiwara K, Watanabe Y, Mitsunaga S, et al.Determination of granulocyte specific antigens onneutrophil Fcγreceptor IIIb by PCR preferentialhomoduplex formation assay, and genefrequencies in Japanese population. Vox Sang1999;77:218.8. Yin T, Jie J,Lixing Y,et al.FCGR3B gene frequenciesand FCGR3 variants in a Chinese population fromZhejiang Province.Ann Hematol 2003;82:574-8.Table 4. FCGR3 variants at nucleotide positions within exon 3 from 12 Tajik subjectsNumber of Number of Nucleotide positionsFCGR3 form individuals clones 141 147 227 266 277 349FCGR3A 12 35 G C G C G AVariant 2 2 2 G C G C A AFCGR3B*1 7 10 G C A C G GFCGR3B*2 9 15 C T G C A AVariant 1 3 7 C T G C G AVariant 3 1 1 G T G C A AFCGR3B*3 3 6 C T G A A A28 I M M U N O H E M A T O L O G Y, V O L U M E  2 1 , N U M B E R  1 , 2 0 0 5L.YAN ET AL.Free Classified Ads and AnnouncementsImmunohematology will publish classified ads and announcements (SBB schools, meetings, symposia, etc.)without charge. Deadlines for receipt of these items are as follows:Deadlines1st week in January for the March issue1st week in April for the June issue1st week in July for the September issue1st week in October for the December issueE-mail or fax these items to Cindy Flickinger, Managing Editor, at (215) 451-2538 or flickingerc@usa.redcross.org.9. Matsuo K, Procter J, Stroncek D.Variants in genesencoding neutrophil antigens NA1 and NA2.Transfusion 2000;40:645-53.10. Bux J, Stein EL, Santoso S, et al. NA genefrequencies in the German population,determined by polymerase chain reaction withsequence-specific primers. Transfusion 1995;35:54-7.Lixing Yan, MD; Faming Zhu, MD; Lei Jin, BA; QinfengLv, BA; and Qihua Fu, PhD, Institute of BloodTransfusion Medicine, Blood Center of ZhejiangProvince, Hangz, Zhejiang, 310006 P. R. China.IMPORTANT NOTICE ABOUT MANUSCRIPTSFORIMMUNOHEMATOLOGYPlease e-mail all manuscripts for consideration to Marge Manigly at mmanigly@usa.redcross.org

FCGR3B polymorphism in three ethnic Chinese populations

https://www.exeley.com/exeley/journals/immunohematology/21/1/pdf/10.21307_immunohematology-2019-389.pdf

FCGR3B polymorphism in three ethnic Chinese populations

Abstract

Similar works

Full text

Available Versions

Exeley Inc.