Infectious bursa disease (IBD) was tentatively diagnosed from an experimental cockerel flock. Clinical signs observed included dullness, diarrhoea characterized by greenish yellow colour and spiking mortality lasting four days. Post-mortem examination results showed pale and slightly enlarged liver and kidney, enlarged and haemorrhagic bursa, petechia haemorrhages on the spleen, keel and thigh muscles and thymus atrophy. Pale liver, thymus atrophy and haemorrhages in the bursa could also be presented in Chicken Infectious Anaemia (CIA) infection. The organs (Bursa, kidney, thymus and liver) from where the infected birds were further screened for IBD and CIA viruses using the polymerase chain reaction technique and were positive for both. This confirms IBD and CIA are responsible for the losses in the flock. This implies that many CIA infections or its mixed infection may be mistaken for IBD alone if no confirmatory diagnosis is carried out, since most post-mortem lesions presenting extensive syndrome are considered to be caused by IBD. &nbsp

Iyiola, S. H.

Oni, O. O.

Owoade, A. A.

English

Federal University of Agriculture, Abeokuta: FUNAAB Journal

REPORT OF MIXED INFECTION OF INFECTIOUS BURSAL DISEASE AND CHICKEN INFECTIOUS  ANAEMIA VIRUSES  *1A.A. OWOADE., 1S.H. IYIOLA AND 2O.O. ONI   1Department of Veterinary Medicine, University of Ibadan, Ibadan. Nigeria.  2Department of Veterinary Medicine & Surgery, University of Agriculture,    Abeokuta, Ogun State. Nigeria.  *Corresponding author: aowoade@yahoo.co.uk  Tel: +2348038311437 of 3 weeks age and older, the second and more important manifestation is a severe, prolonged immunosuppresion of chickens infected at an early age.  Chicken Infections anaemia is a disease in poultry characterized by aplastic anaemia and generalized lymphoid atrophy with concomi-tant immunosuppression and is usually com-plicated by secondary viral, bacterial or fun-gal infections. It was first recognized in young chicken by Yuasa et al. (1979). It has also been reported in Nigeria by Owoade et al. (2004) and Oluwayelu et al. (2005). Chicken Infections Anemia virus (CIAV) plays a major role in many of the multifacto-rial diseases associated with haemorrhagic syndrome and or aplastic anemia. Chicken ABSTRACT Infectious bursa disease (IBD) was tentatively diagnosed from an experimental cockerel flock. Clinical signs observed included dullness, diarrhoea characterized by greenish yellow colour and spiking mor-tality lasting four days. Post-mortem examination results showed pale and slightly enlarged liver and kidney, enlarged and haemorrhagic bursa, petechia haemorrhages on the spleen, keel and thigh mus-cles and thymus atrophy. Pale liver, thymus atrophy and haemorrhages in the bursa could also be presented in Chicken Infectious Anaemia (CIA) infection. The organs (Bursa, kidney, thymus and liver) from where the infected birds were further screened for IBD and CIA viruses using the polymerase chain reaction technique and were positive for both. This confirms IBD and CIA are responsible for the losses in the flock. This implies that many CIA infections or its mixed infection may be mistaken for IBD alone if no confirmatory diagnosis is carried out, since most post-mortem lesions presenting ex-tensive syndrome are considered to be caused by IBD. INTRODUCTION Infectious bursal disease is a highly conta-gious immunosuppressive infection of young chickens (Lukert & Saif, 1997; van den Berg, 2000). The disease is caused by infectious bursal disease virus (IBDV), clas-sified in the Avibirnavirus genus of the family Birnaviridae (Murphy et al., 1995). Infectious bursal disease was first described by Cosgrove (1962) in the US, and subse-quently from other countries including Ni-geria (Ojo et al., 1973; Onunkwo, 1975). The virus is important because of its poten-tial for inducing immunosuppression alone or in combination with other infectious agents. Its economic importance manifests in two ways, first, some IBD virus strains may cause up to 20% mortality in chickens Journal of Natural  Sciences, Engineer-ing and Technology  J. Nat. Sci. Engr. Tech. 2010, 9(1):1-5 1 ISSN - 2277 - 0593 © UNAAB 2010  given to the birds before and during the out-break.  Post mortem examination was carried out on all the birds that died. Samples of the bursa, kidney, thymus and liver were also collected and screened for IBD and CIA using the polymerase chain reaction technique.  Detection of IBD and CIAV by PCR Isolation and purification of RNA from sample Samples were homogenized in PBS, the RNA and DNA were extracted from 140µl of the homogenized samples using the QIAamp viral RNA mini kit following the manufacturers’ instructions.  RT-PCR for IBD RNA Reverse transcription was done by mixing 5µl of extracted RNA with 7µl of mix 1 which consist of 1µl of double distilled H20 (ddH2O), 1µl of   dNTPs (10mM), and 5µl of random primer (0.03 µg/ µl) and was in-cubated at 720C for 10min. Eight microlitre (8µl) of mix 2 which contain 2µl of DDT, 0.5µl of RNAase inhibitor, 0.5 µl of double distilled H20, 4µl of 5x first strand Buffer and 1 µl of superscript was added and then incubate at 500C for 1 hour 20 minutes and 700C for 15 minutes.  Polymerase Chain Reaction (PCR) for IBDV and CIAV The polymerase chain reaction for IBDV and CIAV was done separately by adding 2.5µl of  cDNA (DNA for CIAV) to 22.5µl of PCR mix containing 17.99µl (16.4µl for CIAV) of ddH2O, 2.5µl of 10X PCR Buffer, 1.0µl (2µl for CIAV) of MgCl2 (50mM), 0.5µl of dNTP (10mM), 0.25µl of forward primer F4' (5' AGTGACAGGCCCA-GAGTCTACAC3'), reverse primer R' (ACCAGGTTCTTTGCTAGTTCAG3') Infectious anaemia virus, the only member of the Gyrovirus Circovirus (family Cir-coviridae) is a non-enveloped, icosahedral virus of about 25nm in diameter with a negative sense single-stranded circular DNA genome.  The muscular haemorrhages and the immu-nosuppressive nature of IBD and CIA in-fections do not allow for proper distin-guishing of the infections especially when there is dual infection of birds with both viruses. The pathognomonic enlarged clo-acal bursa in IBD can result in diagnosing all mixed infections of both diseases as IBD infection only, and this will give a false im-pression on the endemicity or prevalence of CIA in the environment. Hence, this study involves using the polymerase chain reac-tion technique in detecting IBD and CIA viruses from bursa, liver, spleen, kidney and thymus obtained from chickens that were tentatively diagnosed with IBD based on post mortem examination.  MATERIALS AND METHODS Sixty day old cockerels were obtained from a local hatchery with the aim of performing chemo prophylactic experiment on them. Birds were raised in experimental cages from day old, chicks mash and water were given ad-libitum and were vaccinated against Newcastle disease orally using the Lasota strain of Newcastle disease vaccine virus at 17 days of age. B1 strain of New-castle disease vaccine had previously been given to the chicks at the hatchery.  Clinical signs including dullness, anorexia, and greenish/yellow diarrhea were noticed when birds were 32 days old and mortalities began to occur before the commencement of the intended experiment. There were no preventive medication and no treatment 1A.A. OWOADE., 1S. H. IYIOLA AND 2O.O. ONI J. Nat. Sci. Engr. Tech. 2010, 9(1):1-5 2 which amplifies 450bp on the VP2 strand of IBDV, 0.5µl of forward primer 03F (5'CAAGTAATTTCAAATGAACG3'), 0.5µl of reverse primer 03R (5'TTGCCATCTTACAGTCTTAT3'), which amplifies 386bp on from the DNA of CIAV  and 0.1µl of taq polymerase (5µ/µl). The PCR reactions were carried out us-ing the following cycling conditions; initial denaturation at 940C for 5min, 35 cycles of amplification at 940C for 30 sec, 580C (540C for CIAV) for 30 sec and 720C for 1min and final extension at 720C for 5min. The PCR product sizes were visualized by UV illumination in 2% agarose gel stained with ethidium bromide as compared to the 1kb+ size market (Invitrogen).  RESULTS AND DISCUSSION Following the occurrence of clinical signs in birds, mortalities began to occur among the birds. Mortality rate had a spiking occur-rence which is characteristic of IBD (Table 1). Post mortem examination carried out on dead birds revealed the presence of a pale and enlarged liver, enlarged kidney, enlarged and hemorrhagic bursa, petechial hemor-rhages on the spleen, hydropericardium with extensive hemorrhages on the keel and thigh muscle (Table 2). The clinical signs and post mortem lesions were suggestive of IBD and a tentative diagnosis of IBD was made. However further examination was carried out using the PCR technique by screening samples from the dead birds for IBDV and CIAV due to presence of exten-sive hemorrhage. The result of the PCR in-dicated all organs including Bursa of Fabri-cius, kidney, liver, spleen and thymus were positive for both IBDV and CIAV. The PCR technique result further confirmed the tenta-tive diagnosis and also detected the involve-ment of another viral infection which would not have been diagnosed ordinarily. Chicken infectious anemia virus is not commonly di-agnosed probably not due to the absence of the virus or low incidence but most likely because it does not have a pathognomonic lesion and laboratory test are not carried out most times. The detection of CIAV further confirms the presence of the virus in Nige-rian poultry flocks as reported by Owoade et al. (2004) were 6 out of 7 flocks tested for CIAV antibody tested positive. Chicken in-fectious anemia seroprevalence in chickens has been reported to be high in many coun-tries (Dergham, 2006). Prior to the detection of CIAV antibody in Nigerian chicken, post mortem examinations presenting haemor-rhagic syndrome in young chicken were con-sidered to be caused by IBDV. None was reported to be a mixed infection of IBD and CIA.  As a result it is recommended that diseases that present extensive hemorrhage at post mortem should undergo further screening for the presence of CIAV. Further studies are also necessary to assess the economic losses due to a mixed infection of IBD and CIA.  REPORT OF MIXED INFECTION OF INFECTIOUS BURSAL DISEASE AND…. J. Nat. Sci. Engr. Tech. 2010, 9(1):1-5 3 Age (days) Clinical signs  Mortality          8            -             1         26            -             1         32 Dullness (35)*             1         33 Dullness and anorexia (35)*             4         34 Dullness. Anorexia and greenish diarrhoea.  (30)*             8         35 Dullness. Anorexia and greenish diarrhoea.  (22)*              1         36 Dullness. Anorexia and greenish diarrhoea.  (12)*              0         37 None              0 Table 1:  Mortality and morbidity pattern  *Number involved  Organ   Lesions Kidney (14)* Slightly enlarged Liver  (16)* Pale and slightly enlarged Bursa (26)* Hemorrhagic and enlarged Spleen (13)* Hemorrhagic Keel and thigh muscle (19)* Extensive hemorrhage Thymus atrophy (22)* Hydropericardium: Table 2: Post Mortem lessions *Number involved                                                                                                                        M=Marker lane, lane 10 = Positive control                                                                                                                           Lane 11 = Negative control.  Lanes 1 to 9 tissue samples Fig 1: Electrophoresis bands of CAV detection  M 1 2  3  4  5 6 7 8  9 10 11     M 386b 1A.A. OWOADE., 1S. H. IYIOLA AND 2O.O. ONI M  1 2  3  4  5  6  7  8   9 10  11  12    M 450bp Fig 2: Electrophoresis band for IBDV            detection J. Nat. Sci. Engr. Tech. 2010, 9(1):1-5 4 ACKNOWLEDGEMENT The authors are grateful to Prof. C.P. Mul-ler of LNS, Institute of Immunology, Lux-embourg for the supply of equipment and reagents used in this study.   REFERENCES Cosgrove, A.S. 1962. An apparently new disease of chickens-avian nephrosis. Avian Dis, 6:385-389.  Dergham, A.R. 2006. Serological survey on the prevalence of chicken infectious ane-mia virus in Commercial broiler chicken flocks in northern Jordan. Int. Jour. of Poult. Sci., 5(6): 544-546  Lukert, P.D., Saif, Y.M. 2003.  Infectious bursal disease.  In: Diseases of Poultry. Eds: Barnes, H. J., Glisson, J. R., Fadly, A. M., McDougald, L. R., Swayne, D. E.  Iowa State University Press edition of 11th edi-tion, 2003.  Murphy, F.A., Fauquet, C.M., Bishop, D.H., Ghabrial, S.A., Jarvis, A.W., Mar-telli, G.P., Mayo, M.A.,  Summers, M.D. 1995. Virus Taxonomy. Classification and No-menclature of  Viruses. Sixth Report of the Inter-national Committee on Taxonomy of Viruses pp. 240–244.  Ojo, M.O., Oduye, O.O., Nobi, L.,      Idowu, A.L. 1973.  Gumboro-like disease in Nigeria. Trop. Anim. Hlth Prod., 5: 52-56.                                                                                                                       Oluwayelu, D.O., Todd, D., Ball, N.W., Scott, A.N.J., Oladele, O.A., Emikpe, B.O., Fagbohun, A. Hemorrhagic and enlarged A., Owoade, A.A., Olaleye, O.D. 2005. Isolation and preliminary characteriza-tion of Chicken anemia virus from chickens in Nigeria. Avian dis., 49: 446-450.  Onunkwo, O. 1975.  An Outbreak of Infec-tious Bursal  Disease (IBD) of chickens in Nigeria. Vet. Rec., 97: 433.  Owoade, A. A., Oluwayelu, D.O., Fagbo-hun, O.A., Ammerlaan, W., Mulders, M.N., Muller, C.P. 2004. Serologic evi-dence of chicken infectious anemia in com-mercial chicken flocks in southwest Nigeria. Avian dis., 48(1): 202-5  Van den Berg, T.P. 2000. Acute infectious bursal disease in poultry: a review. Avian Pa-thology, 29: 175– 194.   Yuasa, N., Taniguchi, T., Yoshida, I. 1979. Isolation and some Characteristics of an inducing Anemia in chicks. Avian Dis.,  23: 366-385.  REPORT OF MIXED INFECTION OF INFECTIOUS BURSAL DISEASE AND…. (Manuscript received: 15th January, 2010; accepted: 18th June, 2010). J. Nat. Sci. Engr. Tech. 2010, 9(1):1-5 5 

Report of Mixed Infection of Infectious Bursal Disease and Chicken Infectious Anaemia Viruses

https://www.journal.unaab.edu.ng/index.php/JNSET/article/view/997/954

Report of Mixed Infection of Infectious Bursal Disease and Chicken Infectious Anaemia Viruses

Abstract

Similar works

Full text

Available Versions

Federal University of Agriculture, Abeokuta: FUNAAB Journal