Abstract A 2.4-kb phi29 polymerase amplification product from serum of a diseased chicken was cloned and sequenced. The 2383-nucleotide sequence showed about 40% identity to a representative genome of chicken anemia virus (CAV), the only member of the genus Gyrovirus, family Circoviridae. The new genome had an organization similar to that of CAV: a putative 5 0 untranscribed region of about 400 nt followed by three partially overlapping open reading frames encoding VP1, VP2 and VP3 homologs. The amino acid identities between these homologs and those of CAV were 38.8%, 40.3%, and 32.2%, respectively. Based on these limited similarities, it is proposed that the newly identified virus is a member of a new species in the genus Gyrovirus. For this new species, the name Avian gyrovirus 2 (AGV2) is proposed

Ana C Franco

Ana P M Varela

F Dos

F Teixeira

Franciscus A M Rijsewijk

Paulo M Roehe

Samuel P Cibulski

Santos • Thais

• Diogenes Dezen

• Helton

CiteSeerX

ANNOTATED SEQUENCE RECORD
Discovery of a genome of a distant relative of chicken anemia
virus reveals a new member of the genus Gyrovirus
Franciscus A. M. Rijsewijk • Helton F. dos Santos • Thais F. Teixeira •
Samuel P. Cibulski • Ana P. M. Varela • Diogenes Dezen • Ana C. Franco •
Paulo M. Roehe
Received: 5 December 2010 / Accepted: 5 March 2011 / Published online: 26 March 2011
 Springer-Verlag 2011
Abstract A 2.4-kb phi29 polymerase amplification
product from serum of a diseased chicken was cloned and
sequenced. The 2383-nucleotide sequence showed about
40% identity to a representative genome of chicken anemia
virus (CAV), the only member of the genus Gyrovirus,
family Circoviridae. The new genome had an organization
similar to that of CAV: a putative 50 untranscribed region
of about 400 nt followed by three partially overlapping
open reading frames encoding VP1, VP2 and VP3 homo-
logs. The amino acid identities between these homologs
and those of CAV were 38.8%, 40.3%, and 32.2%,
respectively. Based on these limited similarities, it is pro-
posed that the newly identified virus is a member of a new
species in the genus Gyrovirus. For this new species, the
name Avian gyrovirus 2 (AGV2) is proposed.
Chicken anemia virus (CAV) is the sole described member
of the genus Gyrovirus of the family Circoviridae [18]. It
was discovered in Japan in 1979, and it causes anemia and
immunosuppression in newly hatched chickens [18, 21].
Based on results of genomic sequencing and expression of
open reading frames (ORFs) of CAV, a 50 untranscribed
region (50UTR) [16] and the coding regions for three viral
proteins, VP1, VP2 and VP3, were identified [6].
In the middle of 2008, a number of three-week-old
chickens in a poultry production unit in the south of Brazil
were noticed to display apathy and loss of weight. In an
attempt to identify circular DNA viruses that may have
contributed to this condition, DNAs from sera of these
chickens were subjected to multiply primed rolling-circle
amplification (MPRCA) [1]. Here, we report the complete
nucleotide sequence of one of the amplified products and
show that this sequence is about 40% identical to the
genome of CAV. It was inferred that it belongs to a new
species in the genus Gyrovirus, for which the name Avian
gyrovirus 2 (AGV2) is proposed.
On July 14, 2008, four sera were taken from diseased
chickens (‘‘Ave-1 to 4’’) of a poultry production unit in Rio
Grande do Sul, Brazil. Isolation of DNA from chicken sera
was performed by phenol extraction as described previously
[2]. The DNA samples (100 ng) were subjected to MPRCA
using Phi 29 DNA polymerase (New England Biolabs, Ips-
wich, MA, USA) [2]. The amplification products were
digested with restriction enzymes, separated on a 0.7%
agarose gel, and cloned in plasmid pUC18 (New England
Biolabs) using standard cloning methods [17]. AGV2 clones
were purified, and about 200 ng of each plasmid was used for
nucleotide sequence analysis on a multi-channel automatic
sequencing device (ACTGene256-Mega Bace, Uppsala,
Sweden) using M13 primers (New England Biolabs) or
specific AGV2 primers (primer- walking approach). Before
The reported sequence has been submitted to GenBank and has
accession number HM590588.
Electronic supplementary material The online version of this
article (doi:10.1007/s00705-011-0971-6) contains supplementary
material, which is available to authorized users.
F. A. M. Rijsewijk (&)  H. F. dos Santos 
A. C. Franco  P. M. Roehe
Virology Laboratory, Microbiology Department, Institute of
Basic Health Sciences, Federal University of Rio Grande do Sul
(UFRGS), Av. Sarmento Leite 500, Porto Alegre, Rio Grande do
Sul (RS) CEP 90050-170, Brazil
e-mail: frans@rijsewijk.com
H. F. dos Santos  T. F. Teixeira  S. P. Cibulski 
A. P. M. Varela  D. Dezen  P. M. Roehe
Institute for Veterinary Research ‘‘Desidério Finamor’’ (IPVDF),
Estrada do Conde 6000, Eldorado do Sul, Rio Grande do Sul
(RS) CEP 92990-000, Brazil
123
Arch Virol (2011) 156:1097–1100
DOI 10.1007/s00705-011-0971-6
sequencing, a GC-rich region was PCR amplified in the
presence of 50% 7-deaza-GTP and 50% dGTP (New Eng-
land Biolabs). The sequences that were obtained were
aligned using the sequence assembly program SeqMantmII
from DNASTAR Inc., Madison, WI, USA, and analyzed
using the Basic Local Alignment Search Tool (BLAST) of
the National Center for Biotechnology Information (NCBI).
Sequence comparisons and phylogenetic analysis were per-
formed using the MegAlign 500 program of DNASTAR Inc.
The four obtained Phi 29 amplification products had a
unit length of 2.4 kb and contained no EcoRI, one ApaI
site, one HindIII site and two Bam HI sites. One of the
amplification products, ‘‘Ave-3’’, was cloned, subcloned,
and sequenced. The nucleotide sequence obtained was
2383 nt long and has been submitted to GenBank with
accession number HM590588. Figure 1 shows the sche-
matic representation of the genomic organization of AGV2
and Fig. 2 shows the position of AGV2 in relation to other
members of the family Circoviridae, including a recently
proposed genus named Cyclovirus [7].
The 50 untranscribed region (50 UTR) of AGV2 is by
definition located between the polyadenylation site and the
start of transcription. Two canonical polyadenylation sig-
nals (AATAAA) were found next to each other between nt
27 and 32 and between nt 39 and 44, where in the
homologous position in CAV there is only one AATAAA
sequence. The actual polyadenylation takes place some 10
to 30 nt downstream of this signal [3]. Using promoter
prediction programs [10, 19], a putative TATA box
(GATATAAG) was identified between nt 415 and 422, and
a transcription start site was postulated at nt 440, which
was located 10 nt upstream of the start of ORF1 (nt 450).
The estimated size of the 50 UTR was thus about 400 nt and
was similar in size to the 50 UTR of CAV [16]. This region
contained six almost perfect direct repeat (DR) regions of
22 nt: 50GTACAGGGGGGTACGTCAt/cCAt/g30. Five or
four (depending on the CAV strain) highly similar versions
of these repeats are found in the 50 UTR of CAV strains [11].
These repeats are thought to act as enhancers of transcription
and may also play a role in viral replication [9].
Using the ORF Finder protocol of the NCBI [13], 14
open reading frames (ORFs) of more than 100 nt were
found in the 2383 nt sequence: eight on the sense strand
and six on the antisense strand. Only the three largest ORFs
showed homology with proteins found in the NCBI data-
base. All three were encoded on the sense strand, but in
different reading frames: ORF1 in frame 3 from nt 450 to
nt 1145, ORF2 in frame 1 from nt 577 to nt 951 and ORF3
in frame 2 from nt 953 to nt 2335 (Fig. 1). They encode
homologs of CAV VP2, VP3 and VP1, respectively.
ORF1 encodes an amino acid sequence of 231 residues,
which displayed 40.3% identity with VP2 of CAV. AGV2
VP2 contains a sequence (CX5R, residues [res.] 107-113—
the large capitals indicate conserved residues) that is highly
conserved in all protein phosphatases (PTPases), including
VP2 of CAV. VP2 of CAV is a dual-specificity PTPase that
plays a role in viral replication, cytopathology and viru-
lence [15]. Interestingly, the phosphatase motif is part of a
larger motif (WX7HX3CX CX5H) that is shared by CAV,
torque teno virus (TTV) and TTV-like mini virus (TLMV)
[20]. In AGV2, this motif is found in the sequence
WLRQCARSHDEICTCGRWRSH (res. 95-115). Only the gyro-
viruses have the PTPase arginine (R) within this motif.
ORF2 encodes an amino acid sequence of 124 residues,
which displayed 32.2% identity with VP3 of CAV. CAV
VP3, or apoptin, was shown to induce apoptosis of hema-
topoietic cells, causing the observed anemia in infected
chickens and to trigger apoptosis of tumor cells, but not of
non-tumor cells [8, 12]. In the N-terminal half of CAV
VP3, a short hydrophobic isoleucine-rich stretch is found
VP3
VP2
VP1
3I 3II 3III3IV
2I
1I 1III1II
1 2383
pA DR TA ST
2335
951577
1145
953
450
R
Fig. 1 Schematic representation of the genomic organization of
AGV2. The horizontal bars in the upper part represent the sizes and
positions of VP3, VP2 and VP1. The numbers above the bars
designate their nucleotide positions. The hatched regions within the
bars indicate the positions of conserved motifs. Within VP3:
3I = isoleucine stretch, 3II = NLS1, 3III = NES and 3IV = NLS2.
Within VP2: 2I = phosphatase motif. Within VP1: R = arginine rich
region, 1I, 1II, 1III = rep motifs I, II and III, respectively. The
horizontal line in the lower part represents the 2383-nt AGV2
genome. The vertical arrows at the start and end of the genome
indicate the positions of the putative stem-loop structures. The open
triangles indicate two polyadenylation signals. The six horizontal
arrows show the positions of the direct repeats found in the 5’ UTR.
The open box indicates the position of a putative TATA box, and the
closed triangle, the putative transcription start site
1098 F. A. M. Rijsewijk et al.
123
(CAV res. 33-46) that is required for self-association as
well as for binding cellular proteins [4]. This amino acid
sequence is well conserved in AGV2 VP3 at res. 38-51. In
the C-terminal half of CAV VP3, a bipartite nuclear
localization sequence (NLS) was identified. The first part
(NLS1) is located at res. 82-88, and the second part (NLS2)
at res. 111-121. Between these two domains, a putative
nuclear export sequence (NES) was found at res. 97-105.
At homologous positions in VP3 of AGV2, NLS-like
sequences were found: RRPRR (res. 84-88) and KKLRL
(res. 120-124). A NES domain, however, was clearly
conserved in AGV2 VP3.
ORF3 encodes an amino acid sequence of 460 residues,
which displayed an identity of 38.8% with VP1 of CAV.
Like other capsid proteins, it starts with a region that is rich
in arginine and lysine residues (27 of the first 60 amino
acids). Three conserved replication motifs have been
identified in VP1 of CAV: FATLT at res. 313-317,
QRWHTLV at res. 351-357, and YALK at res. 402 405 [14].
At the homologous positions, the following sequences were
found in VP1 of AGV2: FAALS (res. 325-329), RRWLTLV
(res. 363-369) and KAMA (res. 412-415). This comparison
suggests that the three motifs are not well conserved and
that the third motif is not conserved at all. Another can-
didate for the third replication motif is a YKFGT sequence
that is present in VP1 of both CAV and AGV2, located
only 7 residues before the YALK/KAMA sequences.
Immediately downstream of the stop codon of VP1 of
AGV2, a 73-nt-long GC-rich sequence (joining nt
2324-2383 to nt 1-23) is found that can form two stem-loop
structures: 5’-gggggggggggttttgccccccccacaaacccccccccc
ccgggggggatcctcccccccg gaccccccg-3’. This sequence
shows 60% identity to the corresponding GC-rich region of
CAV [11].
This is the first time since the discovery of CAV that a
genome of a member of a related species has been dis-
covered. Although there are no proposed rules to demarcate
species in the genus Gyrovirus, there are recognized cri-
teria used for the genus Circovirus: (i) complete nucleotide
sequence identity of less than 75% and (ii) capsid protein
amino acid sequence identity of less than 70% [5]. The
application of these criteria to the data described here
(identities of 40% with the CAV genomic sequence and
38.8% with the CAV capsid protein) justify the description
of this new virus as a member of a separate species in the
genus Gyrovirus.
Acknowledgments We thank Felipe Bardini Rhodenbusch (MV) of
the BIOVET Company, São Paulo, Brazil, who supplied sera of chick-
ens. Helton F. dos Santos is supported by the National Council for
Scientific and Technological Development (CNPq) grant no.141809/
2010-8, and Paulo M. Roehe is a CNPq 1B research fellow. This work
was supported by CNPq research grant no.578436/2008-6.
References
1. Dean FB, Nelson JR, Giesler TL, Lasken RS (2001) Rapid
amplification of plasmid and phage DNA using Phi 29 DNA
polymerase and multiply-primed rolling circle amplification.
Genome Res 11:1095–1099
2. Dezen D, Rijsewijk FA, Teixeira TF, Holz CL, Cibulski SP,
Franco AC, Dellagostin AO, Roehe PM (2010) Multiply-primed
rolling-circle amplification (MPRCA) of PCV2 genomes: appli-
cations on detection, sequencing and virus isolation. Res Vet Sci
88:436–440
3. Edmonds M (2002) A history of poly A sequences: from for-
mation to factors to function. Prog Nucl Acid Res Mol Biol
71:285–389
4. Heilman DW, Teodoro JG, Green MR (2006) Apoptin nucleo-
cytoplasmic shuttling is required for cell type-specific
Fig. 2 Phylogenetic tree based on the alignment of amino acid
sequences of the VP1 capsid proteins of eight different members of
the family Circoviridae and the one described in this study. The avian
gyrovirus described in this study is in bold. The VP1 sequences used
have the following accession numbers: swan circovirus,
ABU48446.1; goose circovirus, AAQ03996.1; PCV1, AAN77864.1;
PCV2, ABD42929.1; bat cyclovirus, ADU77000.1; cyclovirus,
ADU77014.1; cyclovirusTN18, ADD62480.1; chicken anemia virusa,
AAT85595; chicken anemia virusb, ADJ18278; chicken anemia
virusc, AAT85598. The AGV2 sequence has NCBI accession number
HM590588
A new member of the genus Gyrovirus 1099
123
localization, apoptosis, and recruitment of the anaphase-promot-
ing complex/cyclosome to PML bodies. J Virol 80:7535–7545
5. Index of Viruses—Circoviridae (2006) In: ICTVdB—the uni-
versal virus database, version 4. In: Büchen-Osmond C (ed)
Columbia University, New York. http://www.ncbi.nlm.nih.gov/
ICTVdb/Ictv/fs_index.htm
6. Koch G, Van Roozelaar DJ, Verschueren CAJ, Van Der Eb AJ,
Noteborn MHM (1995) Immunogenic and protective properties
of chicken anaemia virus proteins expressed by baculovirus.
Vaccine 13:763–770
7. Li L, Kapoor A, Slikas B, Bamidele OS, Wang C, Shaukat S,
Masroor MA, Wilson ML, Ndjango JB, Peeters M, Gross-Camp
ND, Muller MN, Hahn BH, Wolfe ND, Triki H, Bartkus J, Zaidi
SZ, Delwart E (2010) Multiple diverse circoviruses infect farm
animals and are commonly found in human and chimpanzee
feces. J Virol 84:1674–1682
8. Los M, Panigrahi S, Rashedi I, Mandal S, Stetefeld J, Essmann F,
Schulze-Osthoff K (2009) Apoptin, a tumor-selective killer.
Biochim Biophys Acta 1793:1335–1342
9. Miller MM, Jarosinski KW, Schat KA (2005) Positive and neg-
ative regulation of chicken anemia virus transcription. J Virol
79:2859–2868
10. Neural Network Promoter Prediction of the Berkeley Drosophila
Genome Project. http://www.fruitfly.org/seq_tools/promoter.html
11. Noteborn MH, de Boer GF, van Roozelaar DJ, Karreman C,
Kranenburg O, Vos JG, Jeurissen SH, Hoeben RC, Zantema A,
Koch G, van Ormondt H, van der Eb AJ (1991) Character-
ization of cloned chicken anemia virus DNA that contains all
elements for the infectious replication cycle. J Virol
65:3131–3139
12. Noteborn MH (2009) Proteins selectively killing tumor cells. Eur
J Pharmacol 625:165–173
13. ORF Finder NCBI. http://www.ncbi.nlm.nih.gov/gorf/orfig.cgi
14. Okamoto H, Nishizawa T, Tawara A, Peng Y, Takahashi M,
Kishimoto J, Tanaka T, Miyakawa Y, Mayumi M, Peng YH,
Nishizawa T, Takahashi M, Ishikawa T, Yoshikawa A, Okamoto
H (2002) Analysis of the entire genomes of thirteen TT virus
variants classifiable into the fourth and fifth genetic groups, iso-
lated from viremic infants. Arch Virol 147:21–41
15. Peters MA, Crabb BS, Washington EA, Browning GF (2006)
Site-directed mutagenesis of the VP2 gene of Chicken anemia
virus affects virus replication, cytopathology and host-cell MHC
class I expression. J Gen Virol 87:823–831
16. Phenix KV, Meehan BM, Todd D, McNulty MS (1994) Tran-
scriptional analysis and genome expression of chicken anaemia
virus. J Gen Virol 75:905–909
17. Sambrook J, Russell DW (2001) Molecular cloning: a laboratory
manual, vol 1, 3rd edn. Cold Spring Harbour Laboratory Press,
New York
18. Schat KA (2009) Chicken anemia virus. Curr Top Microbiol
Immunol 331:151–183
19. SoftBerry FPROM program. http://www.softberry.ru/berry.phtml?
group=programs&subgroup=promoter&topic=fprom
20. Takahashi K, Iwasa Y, Hijikata M, Mishiro S (2000) Identifica-
tion of a new human DNA virus (TTV-like mini virus, TLMV)
intermediately related to TT virus and chicken anemia virus. Arch
Virol 145:979–993
21. Yuasa N, Taniguchi T, Yoshida I (1979) Isolation and some
characteristics of an agent inducing anemia in chicks. Avian Dis
23:366–385
1100 F. A. M. Rijsewijk et al.
123


Discovery of a genome of a distant relative of chicken anaemia virus reveals a new member of the genus Gyrovirus

http://citeseerx.ist.psu.edu/viewdoc/download;jsessionid=26B0E1B8B6B30EDBA9BD889EEB8D470B?doi=10.1.1.1054.2618&rep=rep1&type=pdf

Discovery of a genome of a distant relative of chicken anaemia virus reveals a new member of the genus Gyrovirus

Abstract

Similar works

Full text

Available Versions

CiteSeerX