Abstract The aim of this study is to investigate the effects of 2D clinostat-simulated weightlessness on biological characteristics of MLO-Y4 osteocyte-like cells. MLO-Y4 cells were incubated for 24 h and rotated using a 2D clinostat for 2 h. The bioeffects of clinostat culture on cellular morphology, cytoskeleton, and gene expression were investigated. The results show that 2D clinostat-simulated weightlessness induce actin cytoskeleton rearrangement, but unaffected the cellular morphology and number of processes/cell. Also, after 2 h of clinostat culture, expression of RANKL and IL-6 decreased by 19%±5% and 20%±4%, respectively, while cox-2 level increased by 65%±8%. These results provide some clue to explore the cellular mechanism of bone loss caused by weightlessness

Huiyun Xu

Jian Zhang

Long An

Peng Shang

Yuanyuan Weng

CiteSeerX

J. Jpn. Soc. Microgravity Appl. Vol. 28 No. 2 2011 (S31–S35) 
 
 
8th Japan-China-Korea Workshop on Microgravity Sciences  
for Asian Microgravity Pre-Symposium  
 
Effects of Clinostat Culture on Morphology and  
Gene Expression of MLO-Y4 Osteocyte-Like Cells 
Huiyun XU, Yuanyuan WENG, Long AN, Jian ZHANG, and Peng SHANG 
Abstract 
The aim of this study is to investigate the effects of 2D clinostat-simulated weightlessness on biological characteristics of MLO-Y4 
osteocyte-like cells. MLO-Y4 cells were incubated for 24 h and rotated using a 2D clinostat for 2 h. The bioeffects of clinostat culture on 
cellular morphology, cytoskeleton, and gene expression were investigated. The results show that 2D clinostat-simulated weightlessness induce 
actin cytoskeleton rearrangement, but unaffected the cellular morphology and number of processes/cell. Also, after 2 h of clinostat culture, 
expression of RANKL and IL-6 decreased by 19%±5% and 20%±4%, respectively, while cox-2 level increased by 65%±8%. These results 
provide some clue to explore the cellular mechanism of bone loss caused by weightlessness. 
1.  Introduction 
After long-term space flight, some physiological changes 
have taken place to astronauts, such as bone loss, anaemia, 
muscle atrophy and immune alterations. Among them, bone loss 
is the most common physiological change during space flight. 
Previous studies showed the bone loss rate was 3% per month1). 
And many studies have been done on the cellular mechanism of 
bone loss caused by weightlessness in real space and ground-
based experiments. But the exact cellular mechanism is not clear 
yet.  
Osteocytes, the most abundant cells in bone, have been paid 
more attention in recent years. Bonewald et al. (2006,2007,2008) 
thought osteocytes might be main mechanosensing cells in bone 
tissue2-4), which could sense the unloading caused by 
weightlessness, and transfer mechanical signal to osteoblasts 
and osteoclasts, influence the balance of bone formation and 
resorption, lead to bone loss at last.  
Some studies have shown morphological changes of 
osteocytes in vivo happen after real space and simulated 
weightlessness. Rodionova et al. (2002) have reported that after 
space flight (Bion-11), the activity of some young osteocytes 
increase in the iliac crest of monkeys. The destruction of 
osteocytes leads to an increasing quantity of empty osteocytic 
lacunae in bone tissue5). Aguirre et al. (2006) have shown tail 
suspension promotes the prevalence of osteocyte apoptosis, 
followed by bone resorption and loss of mineral and strength6). 
Also, Heino et al. (2009) have shown that damaged osteocytes 
locally affect osteoclast precursors by secreting osteoclastogenic 
factors, and thus play a role in the initiation of resorption in 
bone remodeling7).  
But what happened to osteocytes in vitro under 
weightlessness conditions. The studies are still limited. In 
previous studies, magnetic levitation produced by 
superconducting magnet was used to simulate weightless 
environment, and the results have shown that simulated 
weightlessness causes the changes of morphology, cytoskeleton 
arrangement and gene expression in MLO-Y4 cells8). Also, 
parabolic flight resulted in the changes of cytoskeleton 
architecture, but not morphology and area of MLO-Y4 cells9). 
The objective of this study is to investigate the responses of 
osteocyte-like cells to 2D clinostat-simulated weightlessness 
including morphology, cytoskeleton and gene expression. 
2.  Methods and Materials 
2. 1  Cell culture  
The MLO-Y4 cell line was donated by Professor Lynda 
Bonewald (University of Missouri-Kansas City). The cells were 
cultured in MEM (GIBCO) supplemented with 5% fetal bovine 
serum (FBS) and 5% calf serum (CS) including 1% 
penicillin/streptomycin. Cells were plated on glass slides (2.6 
cm×2.2 cm) at the density of 2.5105 per slide, then cells were 
cultured at 37 °C, 5% CO2 in a humidified atmosphere for 24 h. 
The slides were randomly divided into 3 groups: stationary 
control group (SC), horizontal rotation control group (RC) and 
experimental group (E). 
 
2. 2  Clinorotation  
Clinorotation was performed at 30 rpm according to previous 
Key Laboratory for Space Biosciences & Biotechnology, School of Life Science, Northwestern Polytechnical University, 127 Youyi Xilu,  
Xi’an City, Shaanxi Province 710072, China  
(E-mail: shangpeng@nwpu.edu.cn) 
 
－ S31 －
 
 
Effects of Clinostat Culture on Morphology and Gene Expression of MLO-Y4 Osteocyte-Like Cells 
J. Jpn. Soc. Microgravity Appl. Vol. 28 No. 2 2011 
Table 1 Primer sequences 
Gene name Primer sequences Annealing temperature(°C) Amplication length (bp) 
OPN 
TGACATAGCCATAGGTGAGG 
59 235 
TGCCCTTTCCGTTGTTGTC 
integrin 
GTTCGGAGCAACAGTTCG 
58 488 
TGACATAGCCATAGGTGAGG 
RANKL 
TGACATAGCCATAGGTGAGG 
70 300 
TGACATAGCCATAGGTGAGG 
IL-6 
TGGCTTCGGGAGCACAAC 
55 380 
CTGGCTTTGTCTTTCTTGTT 
Cox-2 
TGGCTTCGGGAGCACAAC 
57 437 
TGGCTTCGGGAGCACAAC 
18S 
AATCAGGGTTCGATTCCGGA3 
55 257 
AATCAGGGTTCGATTCCGGA3 
 
studies10,11), with 3 specially designed flasks having an internal 
diameter of 4 cm in each group. Slides were inserted into a 
specially designed shelf in every flask. In E group, 4 slides were 
placed in the shelf vertically to the bottom of the flask, while in 
SC and RC group 8 slides were placed parallel to the bottom of 
the flask. Then the flask were filled with culture media and 
sealed with a silicon cushion and a plastic lid. Two short needles 
were inserted into the culture flask through two holes on each 
edge of lid, and air bubbles in the flask could be evicted from a 
needle by adding culture medium through another needle. After 
that, 3 flasks of E group were placed on the clinostat and rotated 
around a horizontal axis, while RC group around a vertical axis. 
The flasks of SC group were statically placed on the clinostat. 
2. 3  Haematoxylin–eosin (HE) staining 
Cells were collected and washed twice with PBS, pH 7.4 and 
fixed in 0.5% glutaraldehyde solution in PBS for 10 min. The 
coverslips were placed in 0.5% haematoxylin for 10 min and 
0.5% eosin for 7 min, respectively. Then the cells were 
dehydrated by a series of ethanol solutions with increasing 
concentrations, and made the transparent with dimethylbenzene. 
The cell area, length-width ratio and number of processes/cell 
(the number of dendrite processes per cell) were observed and 
quantified under microscope using simple PCI software. Five 
random fields of vision were observed, and 20-40 cells were 
detected under one field. Statistical analysis was done by 
Graphpad Prism software (La Jolla, CA). The independent 
experiments were repeated three times. 
2. 4  Confocal Imaging 
After washing with PBS, cells were fixed for 10 min with 
0.5% glutaraldehyde solution in PBS at room temperature. Then 
cells were permeabilized using PBS containing 0.1% Triton X-
100 solution and blocked with blocking buffer (PBS+0.1%  
 
Tween +1% serum) for 10min.  
Cells were probed with antibody of rhodamine-phalloidin  
labeled F-actin (1:40, Invitrogen) and α-tubulin (1:2000, Sigma) 
overnight. After washed by TBS with 0.1% Triton, cells were 
incubated for 1 h with FITC labeled (1:10, KPL) secondary 
antibody. Then the cells were washed and observed by confocal 
microscopy (Leica TCS SP5). The images were captured by 
LAS AF Imaging System and further analyzed by NIH image 
software Image J. The independent experiments were repeated 
three times.  
2. 5  RT-PCR 
Cells were lysed by Trizol (Invitrogen, USA), total RNA was 
extracted, and PCR was performed according to the protocol 
provided by RT-PCR reaction kit (TaKaRa, Japan). These 
primer sequences were shown in Table 1. PCR production was 
quantified and analyzed by NIH image software Image J and 
Quality One software. 18S rRNA was used as an internal control 
gene for normalization. The independent experiments were 
repeated three times by different RNA sample. 
2. 6  Statistical Analysis  
Statistical analysis is performed using GraphPad Prism 5 
statistics software (San Diego, USA). All data are expressed as 
means ± standard deviation (SD). One way ANOVA is used for 
statistics analysis. P<0.05 is considered statistically significant. 
3.  Results 
3. 1  Cell Morphology 
There was not significant difference between three groups on 
cell area, length-width ratio (data not shown), and number of 
processes/cell after 2 h of clinostat culture. Also the cell 
morphology wasn’t influenced (Fig. 1, 2). 
－ S32 －
 
 
Huiyun XU, et al. 
J. Jpn. Soc. Microgravity Appl. Vol. 28 No. 2 2011 
 
 
 
 
 
 
 
 
 
 
 
Fig. 1  Analysis of the effects of clinostatation on MLO-Y4 
cell morphology by HE staining. Simple PCI software 
was used to detect cell area, length-width ratio and 
number of processes/cell. SC: stationary control, RC: 
horizontal rotation control, E: experimental  
SC RC E
0
2
4
6
8
n
u
m
b
e
r 
o
f 
p
ro
c
e
s
s
e
s
/c
e
ll
 
Fig. 2  The number of processes/cell was analyzed by simple 
PCI.  There was no significant differences among SC, 
RC and E groups.  
 
 
 
 
 
 
 
 
 
Fig. 3 Confocal microscopy analysis of the effects of 
clinostatation on MLO-Y4 actin fibers(red) and 
microtubules(green. Cells were incubated by antibody 
of rhodamine-phalloidin labeled F-actin (1:40), α-
tubulin (1:2000) and FITC labeled (1:10) secondary 
antibody  
 
3. 2  Cell Cytoskeleton 
In SC and RC groups, F-actin was located mainly at the cell 
periphery or passed through the cytoplasm in the silk structure. 
In E group, actin fibers became thicker than that in SC and RC 
groups. Microtubules distributed in the whole cytoplasm, there 
was not obvious differences among three groups (Fig 3). 
 
 
 
 
 
 
 
 
 
 
 
Fig. 4  RT-PCR analysis of expression of some genes in 
clinorotated MLO-Y4 cells. The bar graph shows the 
quantified results of three independent experiments. 
 
3. 3  Gene Expression 
Compared to SC and RC groups, the expression of some 
genes in mRNA level changed in E group. After 2 h of clinostat 
culture, expressions of OPN and integrin slightly decreased, and 
RANKL and IL-6 decreased by 19%±5% and 20%±4%, 
respectively, while cox-2 level increased by 65%±8% (Fig. 4). 
4.  Discussion 
Space weightlessness could cause bone loss. Bone cells 
change their structure and function to respond to the decrease of 
mechanical stress, which might be a primary cellular mechanism 
of bone loss12). Many studies have shown that osteocytes could 
be a central sensor in bone tissue, which could transfer 
mechanical signal to biochemical signal and influence the 
function of effector cells such as osteoblasts and osteoclasts2, 13).   
In this study 2D clinostat was used to simulate weightlessness, 
which rotate continuously and change the direction of gravity 
vector so that cells among it could not responsd to gravity. 
Some experiments have been done using clinostat in bone 
cells14-15). 
Cytoskeleton plays an important role in responding to 
external mechanical stimuli. Actin-based cytoskeleton may be 
SC            RC             E 
SC                   RC                  
E 
SC             RC               E 
SC                   RC                  
E 
OPN 
18S 
integrin 
18S 
cox-2 
18S 
RANKL 
18S 
IL-6 
18S 
SC  RC  E SC  RC  E 
SC  RC  E 
SC  RC  E 
SC  RC  E 
－ S33 －
 
 
Huiyun XU, et al. 
J. Jpn. Soc. Microgravity Appl. Vol. 28 No. 2 2011 
one of the targets for cells to respond to gravity, which is 
confirmed by previous studies in osteoblasts in space flight and 
ground-based experiments15,16). Also in MLO-Y4 cells, the 
change of cytoskeleton has been observed after parabolic flight 
and magnetic levitation by our group8,9). In this study, actin 
fibers became thicker, especially in the cytoplasm. Actin 
cytoskeleton rearranged to resist to unloading caused by 2 h of 
clinostat culture, which also proved that cytoskeleton be one of 
the targets for cells in responding to mechanical alteration. 
However, no significant change was detected in the overall 
morphology of osteocytes, including the number of 
processes/cell, cell area and length-width ratio. 
Integrin could serve as a mechanosensitive molecule linking 
components of extracellular matrix (ECM) with intracellular 
actin cytoskeleton, and initiate intracellular signaling in bone17). 
In MLO-Y4 cells, high level of beta1 integrin was involved in 
cell adhesion to ECM18). Osteopontin (OPN) could interact with 
integrin, promote cell adhesion with ECM19), and participate in 
the process of bone reconstruction and bone mineralization20). 
Simulated weightlessness could decrease OPN expression in 
osteoblasts21). In this experiment, the expressions of OPN and 
integrin in mRNA level both slightly decreased after 2 h 
clinostatation, to a certain extent, indicating reduction of 
adhesion ability of MLO-Y4 osteocyte-like cells with ECM.  
In addition to regulating structure and appearance to adapt to 
mechanical unloading, osteocyte themselves also can influence 
bone remodeling through soluble factor paracrine or gap 
junction between effector cells13).  
Cox-2 is an inducible isozyme of synthesizing prostaglandins 
(PGs), which play a crucial role as a signal molecule in the 
process of bone metabolism22,23). Receptor activator of nuclear 
factor-κB ligand (RANKL) also is a critical molecule in 
osteoclast formation and activity24,25). Microgravity increase 
osteoblasts’ regulation ability of initiating osteoclastogenesis by 
up-regulating of RANKL/OPG ratio26), and fluid flow stress 
decrease RANKL/OPG ratio and down-regulated 
osteoclastogenesis in MLO-Y4 cells27,28). Interleukin-6 could 
promote osteoclast differentiation and bone resorption in vitro 
and in vivo29). Osteoblasts cultured in rotation wall vessel 
bioeffector (RWV) have shown an upregulation of IL-6 
mRNA30). 
Most of previous researches have shown that after subjected 
to weightlessness, bone cells express more RANKL and IL-6 to 
increase bone resorption, while less cox-2 to reduce bone 
formation. But we got different results after 2 h culture of 
simulated weightlessness, which might be a stress reaction of 
MLO-Y4 cells in acute stage due to compensatory mechanism. 
After a short-time stress of simulated weightlessness, it is 
necessary to osteocytes to rapidly regulate structure and 
function, including gene expression and secretion of some 
soluble factors, to adapt to changed microenvironment.  
In summary, our results show that gene expression and actin 
cytoskeleton arrangement are both sensitive to mechanical 
unloading, which are regulated rapidly to adapt to changed 
mechanical microenvironment in MLO-Y4 cells. These changes 
could be related to osteocytes’ structure and regulation to 
effector cells. And 2 h of clinostat culture do not influence 
tubulin arrangement and overall morphology in MLO-Y4 
osteocyte-like cells. These findings will provide some clue for 
studying the cellular mechanism of bone loss. 
Acknowledgement 
This work was supported by National Natural Science 
Foundation of China (30700152 and 31170812), Northwestern 
Polytechnical University (NPU) Foundation for Fundamental 
Research (Grant No. NPU-FFR-JC201160 & JC201162) and 
Natural Science Basic Research Plan in Shaanxi Province of 
China (Program No. 2011JQ4002). We would like to thank Prof. 
Lynda Bonewald (University of Missouri-Kansas City) for 
gifting MLO-Y4 cells. 
 References  
1) P. Marie, F. Debiais, M. Cohen-Solal and M. C. de Vernejoul: 
Joint Bone Spine, 67 (2000) 150. 
2)   L. F. Bonewald: Ann N Y Acad Sci, 1116 (2007) 281. 
3)   L. F. Bonewald and M. L. Johnson: Bone, 42 (2008) 606. 
4)   L. F. Bonewald: Bonekey Osteovision, 3 (2006) 7. 
5)  N. V. Rodionova, V. S. Oganov and N. V. Zolotova: Adv Space 
Res, 30 (2002) 765. 
6)  J. I. Aguirre, L. I. Plotkin, S. A. Stewart, R. S. Weinstein, A. M. 
Parfitt, S. C. Manolagas and T. J. Bellido: Bone Miner Res, 21 
(2006) 605. 
7)   T. J. Heino, K. Kurata, H. Higaki and H. K. Väänänen: 
Technology and Health Care, 17 (2009) 49. 
8)   A.R. Qian, L. Wang, W. Zhang, L.F. Hu, J. Han, J.B. Li, S.M. Di, 
P. Shang: Biomedical Engineering, IEEE Trans Biomed Eng, 
(2011) Epub ahead of print. 
9)   S.M. Di, A.R. Qian, L.N. Qu, W. Zhang, Z. Wang, Y.H. Li, H.G, 
Ren and P. Shang: Adv Space Res, 8 (2011) 1161. 
10)  Z.Q. Dai, R. Wang, S.K. Ling, Y.M. Wan, Y.H. Li: Cell Prolif, 40 
(2007) 671. 
11)  L. Qu, H. Chen, X. Liu, J. Xiong, Z. Mao, Y. Li: Neurochem Res 
35 (2010) 1445. 
12)  S. B. Doty: Materwiss Werksttech, 35 (2004) 951. 
13)  E. Bonucci: Rend. Fis. Acc. Lincei, 20 (2009) 237. 
14)  S. Makihira, Y. Kawahara, L. Yuge, Y. Mine and H. Nikawa: Cell 
Biol Int, 32 (2008) 1176. 
15)  D. Sarkar, T. Nagaya, Y. Nomura, R. Gruener and H. Seo: Bone 
Miner Res, 15 (2000) 489. 
16)  M. Hughes-Fulford: Adv Space Res, 32 (2003) 1585. 
17)  J. B. Litzenberger, J. B. Kim, P. Tummala and C. R. Jacobs: Calcif 
Tissue Int,86 (2010) 325. 
18)  L. I. Plotkin, I. Mathov, J. I. Aguirre, A. M. Parfitt, S. C. 
Manolagas and T. Bellido: Am J Physiol Cell Physiol, 289 (2005) 
C633. 
19)  K. Matsuzaka, M. Yoshinari, M. Shimono and T. J. Inoue: Biomed 
Mater Res A, 68 (2004) 227. 
20)  M. Morinobu, M. Ishijima, S. R. Rittling, K. Tsuji, H. Yamamoto, 
A. Nifuji, D. T. Denhardt and M. J. Noda: Bone Miner Res, 18 
(2003) 1706. 
21)  Y. M. Wan, Y. J. Ma, X. Y. Zhang, B. Zeng, H. H. Wang and Y. H. 
－ S34 －
 
 
Huiyun XU, et al. 
J. Jpn. Soc. Microgravity Appl. Vol. 28 No. 2 2011 
Li: Sheng Li Xue Bao, 57 (2005) 384. 
22)  P. P. Cherian, B. Cheng, S. Gu, E. Sprague, L. F. Bonewald and J. 
X. Jiang: Biol Chem, 278 (2003) 43146. 
23)  D. Coon, A. Gulati, C. Cowan and J. J. He: Endodont, 33 (2007) 
432. 
24)  E. Lau, S. Al-Dujaili, A. Guenther, D. Liu, L. Wang and L. You: 
Bone, 46 (2010) 1508. 
25)  H. Yasuda, N. Shima, N. Nakagawa, K. Yamaguchi, M. Kinosaki, 
S. Mochizuki, A. Tomoyasu, K.Yano, M. Goto, A. Murakami, E. 
Tsuda, T. Morinaga, K. Higashio, N. Udagawa, N. Takahashi and 
T. Suda: Proc Natl Acad Sci U S A, 95 (1998) 3597. 
26)  N. Rucci, A. Rufo, M. Alamanou and A. Teti: Cell Biochem, 100 
(2007) 464. 
27)  L. You, S. Temiyasathit, P. Lee, C. H. Kim, P. Tummala, W. Yao, 
W. Kingery, A. M. Malone, R. Y. Kwon and C. R. Jacobs: Bone, 
42 (2008) 172. 
28)  P. S. Vezeridis, C. M. Semeins, Q. Chen and J. Klein-Nulend: 
Biochem Bioph Res Co, 348 (2006) 1082. 
29)  R. Axmann, C. Böhm, G. Krönke, J. Zwerina, J. Smolen and G. 
Schett: Arthritis & Rheumatism, 60 (2009) 2747. 
30)  N. Rucci, S. Migliaccio, B. M. Zani, A. Taranta and A. J. Teti: 
Cell Biochem, 85 (2002) 167. 
 
 
 
(Received 21 Sept. 2010; Accepted 29 Jul. 2011) 
  
 
－ S35 －


Effects of Clinostat Culture on Morphology and Gene Expression of MLO-Y4 Osteocyte-Like Cells

http://citeseerx.ist.psu.edu/viewdoc/download;jsessionid=7B2B74A4A86F8B099BC5AD84F02E9970?doi=10.1.1.1044.7292&rep=rep1&type=pdf

Effects of Clinostat Culture on Morphology and Gene Expression of MLO-Y4 Osteocyte-Like Cells

Abstract

Similar works

Full text

Available Versions

CiteSeerX