A Toshev

D Ignatova

M Tacke

P Genova-Kalou

T Barkina

CiteSeerX

 
INHIBITION OF HERPES SIMPLEX VIRUS TYPE 1 INFECTION BY SOME 
SELECTED ANTITUMOR TITANIUM(III)-BASED COORDINATION 
COMPOUNDS 
P. Genova-Kalou 1, T. Barkina 2, D. Ignatova 3, A. Toshev 3 and M. Tacke 4 
National Centre of Infectious and Parasitic Diseases, Department of Virology, Laboratory of Cell Cultures, Sofia, Bulgaria 1 
Sofia Medical University, Faculty of Pharmacy, Sofia, Bulgaria 2  
Sofia Medical University, Faculty of Medicine, Department of Biology, Sofia, Bulgaria 3 
University College Dublin, Centre for Synthesis and Chemical Biology (CSCB), Chemistry Department, Dublin, Ireland 4 
Correspondence to: P. Genova-Kalou 
E-mail: petia.d.genova@abv.bg 
ABSTRACT 
Using a standard plaque assay and clinical strains of Herpes Simplex virus type 1 (HSV 1), we have tested the ability of two 
titanium (Ti) – content complexes – Titanocene Dichloride (Cp2TiCl2) and Titanocene Y. Virus was treated by incubation at 
37oC with both complexes in cell culture media and was then diluted and plated onto human embryonic lung fibroblast cells 
MRC-5 for detection and quantitation of remaining infectious virus. Of one randomly chosen clinical HSV 1 (TM strain), 
sensitive to acyclovir (ACV), was inactivated > 98% by treatment in vitro with 0.01µM Titanocene Y for 2h. The effect was 
concentration dependent. With an HSV 1 strain, 0.01µM Titanocene Y or Cp2TiCl2 caused 99% inactivation, 0.001µM caused 
98 to 99% inactivation, and 0.0001µM caused 63 to 86% inactivation. Short (5 min) treatments of selected isolate with 
Titanocene Y or Cp2TiCl2 yielded inactivation rates of 0 to 55%. We assumed also that Titanocene Y or Cp2TiCl2 could be able 
to affect negatively not only virus DNA synthesis but also another virus target. The data obtained show that: (i) the 300bp 
relatively stable region during a short period of viral replication corresponding to ReIV is amplified in non-treated viral 
control, but not in mock cells and in negative control and (ii) the region was not amplified in Titanocene Y treated samples. The 
data show that the effect of the suppressive therapy of virus replication by Titanocene Y could be due to the suppression of 
immediate early Us1 and Us12 genes encoding essential for virus replication products α22 – the protein affecting virus ability 
to replicate, and α47 – the protein inhibiting MHC I antigen presentation. 
Keywords: Herpes Simplex virus (HSV), inhibition, 
Titanocene Dichloride (Cp2TiCl2), Titanocene Y 
Introduction 
Herpes Simplex virus (HSV) causes diseases ranging from 
“fever blisters” and sexually transmitted disease to 
encephalitis and serious infections in neonates and 
immunocompromised hosts (1 – 4). Acyclovir (ACV) is a 
prodrug and it is the first nucleoside-based therapeutic 
effective for the treatment primary and recurrent HSV 
infections (5). ACV has to be phosphorylated by the viral 
thymidine kinase (TK) and subsequently by cellular kinases 
in order to inhibit competitively HSV DNA polymerase and 
to terminate the viral DNA chain elongation. The two most 
common causes of resistance are mutations in thymidine 
kinase (tk) gene, approximately 95 to 96% of ACV-resistant 
(ACVR) HSV isolates are thymidine kinase (TK) deficient 
(TKN) or TK-partial (TKP) and the remaining isolates are 
usually TK-altered (TKA) mutants unable to phosphorylate 
the pro-drug but not the thymidine (6). The problem for 
effective treatment of HSV infections is still open, since the 
resistance to ACV and the cross resistance to other 
nucleoside analogues increases with relatively high 
frequency.  
Over the past 30 years metal coordination compounds had 
been widely studied for their broad spectrum of human 
pathogens, herpes viruses included (7 – 12). Moreover, 
because of the link existing between herpes viruses and 
malignant transformation, many metal compounds also 
exhibit antitumor properties, which are less toxic than the 
platinum–based drugs (13 – 16). For instance only 
Titanocene dichloride (Cp2TiCl2) has reached Phase I clinical 
BIOTECHNOL. & BIOTECHNOL. EQ. 23/2009/SE              XI ANNIVERSARY SCIENTIFIC CONFERENCE 
SPECIAL EDITION/ON-LINE                   120 YEARS OF ACADEMIC EDUCATION IN BIOLOGY 
               45 YEARS FACULTY OF BIOLOGY 
507
 
trials so far (17). Compared to standard antineoplastic agents 
such as cis-platinum, vinblastine, doxorubicin, Cp2TiCl2 was 
found to exhibit higher cytotoxicity in renal cell carcinoma 
(18). The Cp2TiCl2 was found to exhibit more efficacies in a 
human ovarian cancer xenograft model than cis-platinum 
(19). Recently some derivatives of Cp2TiCl2 showed 
enhanced anti-cancer activity (20). Now scientists all over the 
world are seeking new titanium-based complexes of potent 
antitumor effects with a different mode of action in the hope 
of adding new chemotherapeutic agents to the arsenal of 
weapons used against the world’s most life threatening 
disease, i.e., infectious diseases and cancer.  
Therefore, the aim of this study was to determine the 
antiviral and cytotoxic properties of Cp2TiCl2 and newly 
synthesized titanium(III)-based coordination complex. 
Materials and methods 
Compounds 
Solvents were purified and dried according to the standard 
procedures. Titanocene Y and Titanocene Dichloride 
(Cp2TiCl2) were first dissolved in dimethylsulfoxide (DMSO, 
Serva) to a concentration of 1mM (stock solutions). Serial 
tenfold dilutions (0.00001 – 100 μM) were made from them 
in cells growth medium DMEM (Gibco, USA). All 
compound solutions were prepared ex tempore.  
Cells and viruses 
Continuous human embryonic lung fibroblasts cells (MRC-5) 
were grown as monolayer culture in DMEM supplemented 
with 5% to 10% fetal calf serum (FCS, BioWhiteker, 
Belgium), 50mU/ml penicillin and 50µg/ml streptomycin 
(Balkanpharma, Bulgaria). The culture was maintained at 
37oC in a humidified CO2 incubator. For routine passages 
monolayers were detached using a mixture of 0.05% trypsin 
(Gibco, USA) – 0.02% ethylendiamino tetraacetic (EDTA, 
Gibco, USA). Antiviral experiments were done on the following 
two herpes viruses: one wild (wt) strain TM (HSV 1), sensitive to 
ACV and one ACVR mutant R-100 (TKA, HSV 1). Viruses were 
grown in MRC-5 cell monolayers. Cultures were harvested at full 
cytopathic effect (CPE), freeze thawed and stored at -70oC. 
Methods of determining cell growth, cell viability, 
maximal non-toxic concentration (MNC) and 
concentrations, required cell viability by 50% (CC50) 
Cells were seeded into 96-well tissue culture plates (Grainer, 
Germany) at a concentration of 5 x 104 cells/well and 
cultured at 37oC in a CO2 atmosphere. On the 24h cells from 
confluent monolayers were washed and covered with media 
containing the compounds tested in concentrations from 
0.00001 – 100 μM. Cells grown in compound-free medium 
served as a control. After 24h and 48h the viability of cells 
was read by microscopy of unstained cell monolayers and by 
the MTT-assay and expressed as % from the cells control 
taken as 100%. Each experiment was done in triplicate. The 
MNC and CC50 for each compound were calculated from 
dose-response curves. The maximal concentration, which 
altered neither the morphology of monolayers nor the cell 
survival rate, was recognized as MNC.  
Assay of antiviral activity  
Assay of antiviral activity of the compounds tested was done 
on the basis of their effects on the infectious of different 
strains HSV 1 titers. MRC-5 cells grown in 96-well plates 
were infected with HSV 1 strains in serial tenfold dilutions. 
After 1.5 hr of virus adsorption, infected cells were incubated 
with the compounds tested in serial dilutions (starting from ½ 
MNC) at 37oC for 48 hrs. CPE and virus titer were 
determined for each well. The virus titer was expressed as log 
TCID/0.1 ml. The antiviral activity was expressed as % 
inhibition of virus titer as compared to that of control 
(infected cells incubated in compound-free medium). Dose-
response relationships were constructed by linearly 
regressing compound concentrations against % inhibition 
values derived from virus titrations.  
Direct PCR for determination of the effect on the 
expression of the immediate early (IE) reiterating region 
IV (ReIV) 
Infected and mocked infected cells cultured in compound-
free medium served as controls. PCR amplification 22bp 
primers (Applied Biosystems, USA) were designed to 
amplify 300bp Us1 ReIV region of HSV-1 genome positions 
132333-132634 (21). The sequence (5′→3′) of the primer 
were: ReIVUs1F - 5'TCCGACGACAGAAACCCACC3' and 
ReIVUs1R - 5'GTCCCGGAGGACCACAGTGG3'). PCR 
was performed in a Ready-To-Go-PCR beads thermo cycle 
(Amersham-Pharma Biotech, USA). A 2 μl sample of DNA 
suspension was added to the reaction mixtures and overlaid 
with 25μl of mineral oil (CinnaGen Inc.). PCR amplification 
was carried out as follows: an initial denaturation step of 
94oC for 5min followed by 35 cycles of alternating 
denaturation (94oC for 30sec), primer annealing (60oC for 
60sec) and primer extension (72oC for 60sec). A final 
extension step of 5min at 72oC was included. The PCRs were 
performed in 10μl volume. Briefly, 2μl of the each sample 
were added to a separate tube containing 100μl of lysis 
buffer (Applied Biosystems, USA) and stored at -20oC over 
night. After centrifugation at 12 000rpm for 5min the lysis 
XI ANNIVERSARY SCIENTIFIC CONFERENCE                                      BIOTECHNOL. & BIOTECHNOL. EQ. 23/2009/SE 
120 YEARS OF ACADEMIC EDUCATION IN BIOLOGY                                                        SPECIAL EDITION/ON-LINE 
45 YEARS FACULTY OF BIOLOGY 
508
 
buffer was removed, pallets were re-suspended in nucleolysis 
buffer (300 μl phenol (Sigma, USA), pH7.8; 300μl 
chloroform: isoamyl alcohol = 24 : 1 (Sigma, USA) and 
centrifuged at 12 000 rpm for 5min. DNA was extracted by 
re-suspending the pallets in 10% SDS (Sigma, USA) 
10mg/ml proteinase K (Pharma Biotech, USA), 10mM Tris 
(Sigma, USA) and 0.1mM EDTA (Sigma, USA) at pH 7.4 
and centrifuged at 12 000rpm for 5min. A volume of 2μl of 
supernatants containing 50 – 100ng of the resulting DNA 
suspension was used per PCR mixture. The reaction mixture 
contained 5U/μl cloned recombinant thermo stable STS 
DNA taq polymerase (Applied Biosystems, USA), 
corresponding primers at a concentration of 20μl/ml each 
and 5mM/μl deoxynucleoside triphosphate (Pharma Biotech, 
USA). Amplicons were electrophoresed on a 2% agarose gel 
and visualized by ethidium bromide staining. 
Results and Discussion 
The first obligatory step in antiviral experiments is 
evaluation of their cytotoxicity. Both MNC and CC50 were 
evaluated simultaneously by morphological and by cell 
survival criteria – MTT-assay. When a microscopic 
observation of the morphology of monolayer was carried out 
at intervals of 24h and 48h of the treatment with Titanocene 
Y and Cp2TiCl2 in a concentration ranges respectively from 
100 – 10μM to 2.5 – 1μM a typical cytopatology 
characterizing the toxically effect was registered. This typical 
cytopatology was expressed in a round form of the cells and 
their grouping in the “islands” isolated from the surface of 
the cells. We found some nuclear morphology changes. 
When a treatment with lower concentrations was performed, 
no essential change was registered in the monolayer in 
comparison with cell control. When MNC was defined, no 
essential changes were established in the values according to 
the time of cultivation. During experimentations it was found 
that the cytotoxicity of both compounds increased when the 
concentration increased too. Cp2TiCl2 and Titanocene Y were 
also active against MRC-5 cells in a dose-dependent manner. 
It was found that the cell surveillance depended on both 
complex and cell specificities. In vitro cytotoxicity data for 
the tested Titanocene compounds were summarized in Table 
1. 
Preliminary data presented here show that the tested 
compounds expressed a different degree of cytotoxicity in 
MRC-5 cell line. The less cytotoxic compound according 
MNC was Cp2TiCl2, whose MNC values were 10 and 70 
times lower than those of Titanocene Y. With the 
prolongation of action on MRC-5 cells the cytotoxicity of 
Cp2TiCl2 decreased up to 7 times, while the cytotoxicity of 
Titanocene Y was independent on the duration of action. 
According to CC50 values the investigated compounds at 24h 
and 48h treatment can be arranged as follows: Titanocene Y 
> Cp2TiCl2. In addition, the cytotoxicity of both tested 
compounds increased with the prolongation of treatment, the 
induction of this are the correspondingly 2 and 7 times higher 
values of CC50 at 48h versus those at 24h of action. 
 
TABLE 1.  
Cytotoxic effect of Cp2TiCl2 and TitanoceneY at 24h and 48h 
MNC, μM CC50, μM Compound 
24h 48h 24h 48h 
Cp2TiCl2 0.00001 0.00007 2 1 
TitanoceneY 0.000001 0.000001 0.07 0.01 
 
In the second group of experiments the antiviral activity of 
Cp2TiCl2 and Titanocene Y were evaluated against two 
different strains HSV 1 in cultured cells. Furthermore, the 
data showed that both of tested compounds haven’t 
(Cp2TiCl2) or have very less (Titanocene Y) effects against 
the HSV 1 strain R-100, resistant to ACV in vitro. Both of 
tested compounds inhibited the strain TM growth and 
manifested a structure-activity relationship. The dose-
response effect of Cp2TiCl2 was manifested by concentrations 
under maximal non-toxic (0.001µM), while very less 
inhibition was obtained at a concentration 0.0001µM. With 
an HSV 1 strain, 0.01µM Titanocene Y or Cp2TiCl2 caused 
99% inactivation, 0.001µM caused 98 to 99% inactivation, 
and 0.0001µM caused 63 to 86% inactivation.  
The clinical HSV 1 (TM strain), sensitive to acyclovir 
(ACV), was inactivated > 98% by treatment in vitro with 
0.01µM Titanocene Y for 2h. Short (5 min) treatments of 
selected isolate with Titanocene Y or Cp2TiCl2 yielded 
inactivation rates of 0 to 55%. 
We assumed also that Titanocene Y or Cp2TiCl2 could be 
able to affect negatively not only virus DNA synthesis but 
also another virus target, which is possible to be the  essential 
structure proteins from the β(E) and γ(L) kinetic groups, 
whose synthesis is impossible without α, IE proteins. The 
expression of the immediately earliest α, IE genes by means 
of a direct PCR was studied. A direct multiplying was used 
with PCR by a primer, determining region 300bp, 
corresponding to ReIV region of Us1. The data obtained 
show that: (i) the 300bp relatively stable region during a short 
BIOTECHNOL. & BIOTECHNOL. EQ. 23/2009/SE              XI ANNIVERSARY SCIENTIFIC CONFERENCE 
SPECIAL EDITION/ON-LINE                   120 YEARS OF ACADEMIC EDUCATION IN BIOLOGY 
               45 YEARS FACULTY OF BIOLOGY 
509
 
period of viral replication corresponding to ReIV is amplified 
in non-treated viral control, but not in mock cells and in 
negative control and (ii) the region was not amplified in 
Titanocene Y treated samples.  
 
 
Fig. 1. Amplification of ReIV containing region within wt HSV 1 genome. 1 
– Negative control (lane 1); 2 – Markers (lane 2); 3 – Cell control (mock 
infected cells cultured in compound-free medium) (lane 3); 4 – Positive control 
(HSV 1, strain TM infected cells cultured in compound-free medium) (lane 
4); 5 – Titanocene Y (lane 5) and 6 – Cp2TiCl2 (lane 6). 
 
In conclusion, HSV 1 strains, sensitive and resistant to ACV 
can be efficiently inactivated by treatment with Titanocene Y 
than Cp2TiCl2 in vitro. The suppressive therapy of virus 
replication by Titanocene Y could be due to the suppression 
of immediate early Us1 and Us12 genes encoding essential 
for virus replication products α22 – the protein affecting 
virus ability to replicate, and α47 – the protein inhibiting 
MHC I antigen presentation. 
Acknowledgments 
The authors wish to thank the Prof. Matthias Tacke from 
University College Dublin (Ireland) Chemistry Department, 
for supplying of both titanium-based coordination 
compounds.  
 
REFERENCES 
1. Bastian et al (1972) Science 178: 306 – 307. 
2. Baringer et al (1973) N  Engl J Med  288: 648 – 650. 
3. Corey et al (2004)  JAIDS 35: 435 - 445. 
4. Smith et al (1986) Diagn Microbiol Infect Dis 4:147-
152 
5. Field (2001) J Clin Virol 21: 261 – 269. 
6. Bacon et al (2003) Clin Microbiol Rev 16: 114 – 128. 
7. Varadinova et al (2001) Acta Virolog 45: 87 – 94. 
8. Genova et al (2004) Toxicol Appl Pharmacol 197:107–
112. 
9. Marchetti et al (1997) Biometals 11: 89 – 96. 
10. Turel et al (2002) Eur J Inorg Chem 8: 1928 – 1931. 
11. Gökce et al (2005) Eur J Med Chem 40: 135 – 141. 
12. Kovala-Demertzi et al (2007) Bioinorg Chem Appl 
56165: 6 pages. 
13. Treshchalina et al (1979) Dokl Akad Nauk (SSSR) 248: 
1273 – 1276. 
14. Brown et al (1982) J Med Chem 25: 952 – 956. 
15. Rho et al (2002) Int J Oncol 20: 929 – 935. 
16. Mirabelli et al (1987) J Med Chem 30: 2181 – 2190. 
17. Christodoulou et al (1998) J Clin Oncol 16: 2761 – 
2766. 
18. Kurbacher et al (1994) Anticancer Res 14: 1529 – 
1533. 
19. Friedrich et al (1998) Eur J Gynaecol Oncol 19: 333 – 
337. 
20. Boyles et al (2001) J Inorg Biochem, 84: 159 – 162. 
21. Maertzdorf et al (1999) J Clin Microbiol 37: 3518 - 
3523. 
 
XI ANNIVERSARY SCIENTIFIC CONFERENCE                                      BIOTECHNOL. & BIOTECHNOL. EQ. 23/2009/SE 
120 YEARS OF ACADEMIC EDUCATION IN BIOLOGY                                                        SPECIAL EDITION/ON-LINE 
45 YEARS FACULTY OF BIOLOGY 
510


INHIBITION OF HERPES SIMPLEX VIRUS TYPE 1 INFECTION BY SOME SELECTED ANTITUMOR TITANIUM(III)-BASED COORDINATION COMPOUNDS

http://citeseerx.ist.psu.edu/viewdoc/download;jsessionid=D3467E58A074BCEDC07CDA9729048152?doi=10.1.1.1044.3032&rep=rep1&type=pdf

INHIBITION OF HERPES SIMPLEX VIRUS TYPE 1 INFECTION BY SOME SELECTED ANTITUMOR TITANIUM(III)-BASED COORDINATION COMPOUNDS

Abstract

Similar works

Full text

Available Versions

CiteSeerX