ABSTRACT: Peanut bud necrosis virus (PBNV) is an important re-emerging viral pathogen in onion (Allium cepa L.) in India. The virus transmitted by thrips vectors; it belongs to the genus Tospovirus and family Bunyaviridae. The onion crop infected by PBNV and it is a major problem in Southern India. This paper presents the comparison of DAC-ELISA and RT-PCR in the detection of PBNV infected onion samples from South India. The PBNV suspected onion samples (n=145) were collected in the major growing areas of Andhra Pradesh, Tamil Nadu and Karnataka states from South India. Among these collected onion samples, Seventy five samples (51.72%) were confirmed as PBNV infected by DAC-ELISA using the PBNV specific antiserum and in RT-PCR method one hundred twenty four samples (85.51%) were amplified (~800bp) by using the PBNV-CP gene specific primers. In comparison studies the RT-PCR method has added the advantage that it is more sensitive than the DAC-ELISA in the detection of PBNV in onion

Andhra Tirupati

Bhaskara Reddy Bv

India Pradesh

Mahila Visvavidyalayam

Sivaprasad Y

Sri Padmavati

Sujitha A

Usha R

CiteSeerX

Volume-5, Issue-3, July-Sept-2015 Coden:IJPAJX-CAS-USA, Copyrights@2015 ISSN-2231-4490 
Received: 20th May-2015                              Revised: 24th June -2015            Accepted: 25th June-2015 
Research article 
 
COMPARISON OF ELISA AND RT-PCR FOR THE DETECTION OF PEANUT BUD 
NECROSIS VIRUS IN ONION (ALLIUM CEPA.L) 
 
 
Sujitha Aa, Bhaskara Reddy BVb*, Sivaprasad Yb and Usha Ra 
 
 
aDepartment of Biotechnology, Sri Padmavati Mahila Visvavidyalayam, Tirupati, Andhra Pradesh, 
India 
bGenomics Lab, Institute of Frontier Technology, Tirupati, Andhra Pradesh, India 
*Corresponding author, e-mail: bvbreddy68@gmail.com 
ABSTRACT: Peanut bud necrosis virus (PBNV) is an important re-emerging viral pathogen in onion (Allium 
cepa L.) in India. The virus transmitted by thrips vectors; it belongs to the genus Tospovirus and family 
Bunyaviridae. The onion crop infected by PBNV and it is a major problem in Southern India. This paper 
presents the comparison of DAC-ELISA and RT-PCR in the detection of PBNV infected onion samples from 
South India. The PBNV suspected onion samples (n=145) were collected in the major growing areas of Andhra 
Pradesh, Tamil Nadu and Karnataka states from South India. Among these collected onion samples, Seventy 
five samples (51.72%) were confirmed as PBNV infected by DAC-ELISA using the PBNV specific antiserum 
and in RT-PCR method one hundred twenty four samples (85.51%) were amplified (~800bp) by using the 
PBNV-CP gene specific primers. In comparison studies the RT-PCR method has added the advantage that it is 
more sensitive than the DAC-ELISA in the detection of PBNV in onion.  
Key words: DAC-ELISA, Onion, Peanut bud necrosis virus, RT-PCR 
 
INTRODUCTION 
Onion (Allium cepa.L.) is one of the most important global horticultural crop cultivated in tropical and 
subtropical regions of the world and it is grown on 85.9 million tons from 4.44 million ha. In India it is grown 
in an area of 12.04 million ha with production of 19.40 million tonnes [1]. The onion productivity is affected by 
many biotic and abiotic stresses. Among the biotic stresses, viruses cause high qualitative and quantitative 
losses. More number of viruses reported to infect onion in worldwide belongs to the genera Allexivirus, 
Carlavirus, Nepovirus, Potyvirus, Ilarvirus and Tospovirus [2, 3, 4]. Most of the viruses incite more or less 
similar kind of disease symptoms i.e chlorotic mosaic streaks, spots, leaf striping and curling, stunting and 
necrotic tips on the leaves of the onion. Among the viral diseases, Peanut bud necrosis disease (PBND) is one of 
the threatened diseases in onion.                      
Peanut bud necrosis virus is the type species of the genus Tospovirus of the family Bunyaviridae consists of 
enveloped, quasi spherical particles, approximately 80–120 nm in diameter and has a tripartite, single-stranded, 
ambisense RNA genome. The RNAs are designated L (large), M (medium) and S (small) and have a size of c. 
8.9, 4.8 and 2.9 kb, respectively. They are bounded by nucleocapsid (N) protein [5]. The L-RNA codes for the 
RNA-dependent RNA polymerase and is translated from the viral complementary sense RNA (vc). The m-RNA 
encodes a non-structural (NSm) protein in the viral (v) sense and the precursor for the glycoprotein’s G1 and G2 
in the VC sense. Among six serogroups of Tospovirus, only serogruop VI (Iris yellow spot virus) has been 
reported to infect the onion crop [6]. GBNV has a wide host range, infecting vegetable, fruit, oil seeds, 
ornamental crops and weeds with severe economic losses [7]. The incidence of groundnut bud necrosis disease 
ranges from 5 to 80% in different parts of the Indian subcontinent. GBNV is transmitted by thrips (Thrips 
palmi) in a persistent manner [8]. Only ten species of thrips were reported as vectors of tospoviruses recorded in 
the Worldwide [9]. Meena et al. [10] from India detected the presence of Tospovirus in S.dorsalis. Recently, 
natural infection of Jute and Taro [11, 12], Calotropis [13] (Bhaskara Reddy et al. 2011), Onion [4] and Jasmine 
[14] with PBNV was also reported.  
 
International Journal of Plant, Animal and Environmental Sciences               Page: 95                               
Available online at www.ijpaes.com 
 
Sujitha et al                                                                                       Copyrights@2015 ISSN 2231-4490 
 
The Peanut bud necrosis disease in onion is characterized by straw colored, mosaic and necrotic lesions were 
observed on the young leaves. The necrosis starts with the apical portion of young leaves and flower stalks and 
finally flower abortion and plant death. 
The objective of the present study was to develop a reliable method to detect PBNV in the onion plants. A 
reverse transcriptase-polymerase chain reaction (RT-PCR) was developed to detect the presence of PBNV and 
the results were compared with those obtained using ELISA.  
 
MATERIALS AND METHODS 
Virus isolates  
The Peanut bud necrosis virus suspecting onion plants (n=145) were collected from different places in Andhra 
Pradesh, Karnataka and Tamil Nadu states of India. The PBNV infected onion plants showed symptoms like 
straw colored, mosaic and necrotic lesions on the young leaves of onion stalks (Fig.1). 
Enzyme linked immunosorbent assay (ELISA) 
The onion samples were collected from the different places in South India subjected to direct antigen coating-
ELISA (DAC-ELISA) [15] using specific polyclonal TSV antiserum. The suspected leaf samples were ground 
in carbonate buffer (pH 9.6) at 1:10 dilution (w/v) and crude leaf extracts were used as antigens. The healthy 
leaf tissue extract was used as a control. 100 µl of each sample extract was loaded into wells of ELISA plates 
(Nunc MaxiSorb; Denmark) and incubated at 37°C for 60 min. The antigen coated plates were washed three 
times with PBS-T buffer. The plates were then blocked with blocking buffer (PBS-TPO with 5% skimmed milk 
powder) and incubated at 37°C for another 60 min. The plates were then washed with PBS-T as described 
above. The polyclonal antisera of PBNV was used as primary antibodies at 1:5000 (v/v) dilutions in antibody 
buffer (PBS-TPO- 0.15 M NaCl in 0.1 M phosphate buffer pH 7.4, 0.05% Tween 20, 2% polyvinyl pyrrolidine, 
0.2% ovalbumin), incubated for 60 min at 37°C and washed three times with PBS-T as above. Goat antirabbit-
ALP conjugate (Sigma, Germany) at 1:10000 (v/v) dilution in antibody buffer was added and incubated at 37°C 
for 60 min. Para-nitrophenyl phosphate (PNPP) (Sigma, Germany) was used as a substrate at 5 mg / 10 ml of 
substrate buffer (Diethanolamine buffer, pH 9.8). Absorbance values were recorded in an ELISA plate reader 
(Bio-Rad, USA) at 405 nm after 15-30 min of substrate addition. Antigen buffer control was included along 
with leaf antigen samples. The reactions were terminated using 3 N NaOH (50µl/well). Only positive samples 
whose A405 values were twice or more greater than twice the value of healthy onion samples was considered as 
virus infected. 
The ELISA positive samples were maintained in local lesion assay host as Vigna unguiculata (cv-C 152) 
cultivar was used following sub-culturing for three generations on the same host and later maintained on their 
natural hosts for further studies.  
 
Preparation of total RNA and RT-PCR 
Total RNA from 100 mg of healthy and GBNV infected onion leaf samples was isolated using RNeasy Plant 
Minikit according to the manufacturer’s instructions (Qiagen, Germantown, MD, USA). The resulting total 
RNA was incubated with GBNV-CP gene-specific reverse primer at 65°C for 5 min and snap-chilled on ice for 
2 min. cDNA was synthesized using M-MuLV reverse transcriptase (Fermentas, Ontario, Canada) at 42°C for 1 
h. The genome sense primer, 5′ATGTCTAACGT(C/T) AAGCA (A/G) CTC 3′, and antisense primer, 
5′TTACAATTCCAGCGAAGGACC 3, were used to amplify the complete CP gene of GBNV [16]. Two 
micrcolitre of cDNA was amplified in a 25 µl reaction volume containing 2.5 U of Taq DNA Polymerase 
(Fermentas), 10 pmol of forward (GBNV-CP-F) and reverse primer (GBNV-CP-R), 2.5 mM MgCl2 and 10 mM 
each dNTP’s. PCR amplification conditions included an initial denaturation cycle of 5 min at 94°C, followed by 
35 cycles of denaturation for 30 s at 94°C, annealing for 1 min at 56°C and extension for 1 min at 72°C with 
final extension for 60 min at 72°C. Amplified products were resolved following electrophoresis through a 1% 
agarose gel containing ethidium bromide (10 mg/ml). 
 
RESULTS  
The presence of PBNV was detected in 96 of the 145 onion plants from different places of the Andhra Pradesh, 
Tamil Nadu and Karnataka States from India. The symptoms of straw colored, mosaic and necrotic lesions were 
observed on the young leaves. The necrosis starts with the apical portion of young leaves and flower stalks and 
finally flower abortion and plant death (Fig. 1). 
 
 
International Journal of Plant, Animal and Environmental Sciences               Page: 96                               
Available online at www.ijpaes.com 
 
Sujitha et al                                                                                       Copyrights@2015 ISSN 2231-4490 
 
 
Fig. 1: Symptoms associated with natural occurrence of Peanut bud necrosis virus on onion: straw 
colored, mosaic and necrotic lesions were observed on the young leaves. 
 
ELISA 
Based on above symptomatology, the PBNV was confirmed by direct antigen coating (DAC)-ELISA (Clark and 
Joseph 1984) by using PBNV polyclonal antibodies (A405= 2.15). The sensitivity of ELISA for the detection of 
PBNV was evaluated using 145 onion plant leaf samples. Seventy five samples (51.72%) were confirmed as 
PBNV infected by ELISA by using the PBNV coat protein specific antiserum during the year 2010-2014 
(Table.1). 
 
Table 1. Collection and screening of Peanut bud necrosis virus (PBNV) infecting onion samples from 
different locations in South India. 
S.No Place Crop No. of Samples ELISA RT-PCR 
 Andhra Pradesh     
1 Chittoor Onion 15 5 12 
2 Kadapa Onion 9 7 8 
3 Kurnool Onion 12 10 11 
4 Nellore Onion 10 4 9 
5 Guntur Onion 4 1 3 
6 Ananthapur Onion 8 3 7 
7 Medak Onion 5 3 4 
8 Karimanagar Onion 6 4 5 
9 Visakapatnam Onion 5 2 4 
 Tamil Nadu     
10 Perambalur       Onion 10 7 9 
11 Dindugul Onion 7 5 6 
12 Coimbatore Onion 9 4 7 
13 Tiruchirappalli    Onion 10 5 9 
14 Karnataka     
15 Dharwad Onion 9 5 8 
16 Kolar Onion 11 6 10 
17 Tumkur Onion 7 2 5 
18 Raichur Onion 8 2 7 
   145 75 
(51.72%) 
124 
(85.51%) 
 
 
 
International Journal of Plant, Animal and Environmental Sciences               Page: 97                               
Available online at www.ijpaes.com 
 
Sujitha et al                                                                                       Copyrights@2015 ISSN 2231-4490 
 
The PBNV was easily sap transmitted to cowpea (Cv-c-152); both localized and systemic symptoms were 
observed on cowpea plants. After 3-5 days inoculation, initially chlorotic lesions were observed on cowpea 
leaves, which later turned into necrotic spots, followed by veinal necrosis. Finally, the pale yellow color was 
observed in leaves before senescence. The Emerging new leaves will be shown systemic symptoms which 
consisted of mild mosaic, chlorotic ring spots and necrotic spots. The virus-affected cowpea plants reacted with 
the PBNV polyclonal antiserum directed against the coat protein of PBNV. 
 
RT-PCR 
The total RNA was extracted from the infected onion tissue and subjected to RT-PCR by using the coat protein 
gene of PBNV resulted in an amplicon with the expected size of ~800 bp (Fig. 2) for 124 of the 145 onion 
samples (85.51%) during the 2011-2014 (Table 1). The amplified PCR product was sequenced and matched the 
PBNV coat protein gene sequence. 
Comparative sensitivities of ELISA and RT-PCR: 
The ELISA has been used to detect PBNV in onion plants, but gave fewer results when compared to RT-PCR. 
These results showed that RT-PCR is more sensitive than ELISA. 
 
Fig. 2: Agarose gel electrophoresis of RT-PCR products. Lane M- 1Kb DNA ladder; Lane H- Healthy 
onion sample; Lane 1, 2, 3, 4, 5, 6- PBNV infected onion samples. 
 
DISCUSSION  
PBNV is easily transmissible to members of Solanaceae, Leguminosae, Cucurbitaceae and Fabaceae [17]. The 
PBNV has a wide host range and it infects several hosts such as cowpea, groundnut, mung bean, potato, soya 
bean, tomato, taro, calotropis, jute and jasmine [18, 19, 20, 12, 13, 11, 14]. This work presents the sensitivity 
comparison of two diagnostic methods, RT-PCR and ELISA in the detection of PBNV in onion. The symptoms 
of GBNV first appeared in the young leaflets such as straw colored, mosaic and necrotic lesions. If the PBNV 
infection occurs at a young age, it results in the death of the plant due to severe necrosis. The PBNV infected 
onion samples were confirmed by ELISA using the polyclonal antibodies of coat protein gene of PBNV. The 
confirmation of ELISA positive samples were maintained in cowpea (Cv-c-152). After five days sap 
inoculation, both localized and systemic infections were observed on cowpea plants. The PBNV affected 
cowpea plants reacted with the polyclonal antiserum directed against coat protein of PBNV (A405 = 1.89). 
Among these (n=145) collected onion samples, 75 samples (51.72%) were confirmed as PBNV infected by 
direct antigen coating enzyme linked immunosorbent assay (DAC-ELISA) by using the PBNV specific 
antiserum, where as 124 samples (85.51%) were confirmed by RT-PCR. A single band of the expected size of 
~800 bp corresponding to the coat protein gene of PBNV was observed when total RNA extracted from infected 
tissue was used in RT-PCR.   
 
CONCLUSION  
The results indicate that this molecular technique (RT-PCR) is a more reliable assay for the detection of PBNV 
onion plants when compared to ELISA method.  
International Journal of Plant, Animal and Environmental Sciences               Page: 98                              
Available online at www.ijpaes.com 
 
Sujitha et al                                                                                       Copyrights@2015 ISSN 2231-4490 
 
ACKNOWLEDGEMENTS 
The authors are thankful to the Acharaya N.G. Ranga Agricultural University, Hyderabad, India for financial 
assistance. 
 
REFERENCES 
 
[1] National Horticultural Board, 2015. (http://nhb.gov.in/area%20_production.html)  
[2] Maliogka VI, Dovas CI, Lesemann DE, Winter S and Katis NI. 2006. Molecular identification, reverse 
transcription-polymerase chain reaction detection, host reactions, and specific cytopathology of 
Artichoke yellow ringspot virus infecting onion crops. Phytopathology. 96: 622–629. 
[3] Sivaprasad Y, Bhaskara Reddy BV, Rekha Rani K, Raja Reddy K and Sai Gopal DVR. 2010. First report of 
Tobacco streak ilarvirus infecting onion (Allium cepa L.). New Dis. Rep. 22: 17. doi:10.5197/j.2044-
0588.2010.022.017. 
[4] Sujitha A, Bhaskara Reddy BV, Sivaprasad Y, Usha R and Sai Gopal DVR. 2012. First report of Groundnut 
bud necrosis virus infecting onion (Allium cepa L.). Australas. Plant Dis. Notes. 7: 183–187. 
[5] Fauquet CM, Mayo MA, Maniloff J, Desselberger U and Ball LA. 2005. Virus Taxonomy: Eighth Report of 
the International Committee on Taxonomy of Viruses. Elsevier Academic Press, San Diego, CA, USA. 
[6] Ravi KS, Kitkaru AS and Winter S. 2006. Iris yellow spot virus in onions: A new tospovirus record from 
India. Plant Pathol. 55: 288. 
[7] Reddy, DVR, Buiel, AAM, Satyanarayana, T, Dwivedi, SL, Reddy, AS, Ratna, AS, Vijaylakshmi, K, Ranga 
Rao, GV, Naidu, RA and Wightman, JA. 1995. Peanut bud necrosis virus disease: an overview. In: 
Recent Studies on Peanut Bud Necrosis Disease: Proceedings of a Meeting. March 20, 1995, ICRISAT 
Asia Centre (Eds. Buiel, AAM, Parlevliet, JE, Lenne, JM), 3–7. 
[8] Reddy DVR and Devi KT. 2003. Peanuts. In. Viruses and virus like diseases of major crops in developing 
countries (Eds. Gad Loebenstein and George Thottappilly). Kluwer Academic Publishers, Dorderecht, 
397-423. 
[9] Ullman DE, Sherwood JL and German TL. 1997. Thrips as vectors of plant pathogens. In: Thrips as crop 
pests. (Ed. Lewis T), CAB International, Wallingford, UK. 539–565. 
[10] Meena RL, Venkatesan TRS and Mohankumar S. 2005. Molecular characterization of Tospovirus 
transmitting thrips populations from India. Am. J. Biochem. Biotechnol. 1: 167–172. 
[11] Sivaprasad Y, Bhaskara Reddy BV, Naresh Kumar CVM, Raja Reddy K and Sai Gopal  DVR. 2011a. Jute 
(Corchorus capsularis): a new host of Peanut bud necrosis virus. New Dis. Rep. 23: 33. 
[doi:10.5197/j.2044-0588.2011.023.033] 
[12]Sivaprasad Y, Reddy BVB, Kumar CVMN and Sai Gopal DVR. 2011b. First report of Groundnut Bud 
Necrosis Virus infecting Taro (Colocasia esculenta). Australas. Plant Dis. Notes. 6: 30–32. 
doi:10.1007/s13314-011-0011-0. 
[13] Bhaskara Reddy BV, Sivaprasad Y and Sai Gopal DVR. 2011. First report of Groundnut bud necrosis virus 
on Calotropis gigantean. J Plant Pathol. 93:63-89. doi: 10.4454/jpp.v93i4.2403 
[14]   Sujitha A, Bhaskara Reddy BV, Sivaprasad Y, Usha R and Sai Gopal DVR. 2013. First report of 
Groundnut Bud Necrosis Virus infecting Jasmine. J Plant Pathol. 95: 659-668. 
doi: 10.4454/JPP.V95I3.033 
[15] Clark MF, Bar-Joseph. 1984. Enzyme immunosorbent assays in plant virology. In: Methods In Virology, 
Vol VII (Eds. K Maramorsch and H Koprowski). pp. 51-85. Academic Press, New York. 
[16] Satyanarayana T, Mitchell SE, Reddy DVR, Kresovich S, Jarret R, Naidu RA, Gowda S and Demski JW. 
1996. The complete nucleotide sequence and genome organization of the M RNA segment of peanut 
bud necrosis tospovirus and comparison with other tospoviruses. J. Gen Virol. 77: 2347-2352. 
[17] Prins M, Kikkert M, Ismayadi C, deGraauw W, deHaan P and Goldbach R. 1997. Characterization of 
RNA-mediated resistance to tomato spotted wilt virus in transgenic tobacco plants expressing NSM 
gene sequences. Plant Mol Biol. 33: 235–243. 
International Journal of Plant, Animal and Environmental Sciences               Page: 99                               
Available online at www.ijpaes.com 
 
 
Sujitha et al                                                                                       Copyrights@2015 ISSN 2231-4490 
 
[18] Bhat AI, Jain RK, Varma A, Chandra N and Lal SK. 2001. Tospovirus (es) infecting grain legumes in 
Delhi – their identification by serology and nucleic acid hybridization. Indian Phytopath. 54: 112-116. 
[19] Thien HX, Bhat AI and Jain RK. 2003. Mungbean necrosis disease caused by a strain of Groundnut bud 
necrosis virus. Omonrice. 11: 110–116. 
[20] Jain RK, Paul Khurana SM, Bhat AI and Chaudhary V. 2004. Nucleocapsid protein gene sequence studies 
confirm that potato stem necrosis disease is caused by a strain of Groundnut bud necrosis virus. Indian 
Phytopath. 57: 169–173. 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
International Journal of Plant, Animal and Environmental Sciences               Page: 100                             
Available online at www.ijpaes.com 
 
 
 


COMPARISON OF ELISA AND RT-PCR FOR THE DETECTION OF PEANUT BUD NECROSIS VIRUS IN ONION (ALLIUM CEPA.L)

http://citeseerx.ist.psu.edu/viewdoc/download;jsessionid=40DF28EC26CA0614445097EF1CF3CBF2?doi=10.1.1.1040.8950&rep=rep1&type=pdf

COMPARISON OF ELISA AND RT-PCR FOR THE DETECTION OF PEANUT BUD NECROSIS VIRUS IN ONION (ALLIUM CEPA.L)

Abstract

Similar works

Full text

Available Versions

CiteSeerX