About A Rare Cause Of Primary Hyperparathyroidism

Introduction: Primary hyperparathyroïdism is observed in 35 to 44 subjects/ 100000 persons. The increased production of parathyroid hormones is secondary to primary glandular modifications consisting mainly in adenomas. The authors report a clear-cell hyperplasia causing primary hyperparathyroidism. Observation: We report the case of a 25-year-old man who was admitted to explore pathologic fractures of the left arm and a malignant hypercalcaemia. Complementary laboratory tests revealed primary hyperparathyroidism. A multiple endocrine neoplasia was excluded by radiologic examinations. Cervical ultra-sound examination revealed 2 parathyroid adenomas and per-operative exploration showed 3 « adenomas ». Microscopic examination of the 4 parathyroid glands specimen concluded to a clear cell hyperplasia. Conclusion: Clear cell hyperplasia is a benign cause of primary hyperparathyroidism. The diagnosis is based upon histologic findings and examination of the 4 glands

Pituitary hyperplasia mimicking macroadenoma associated with primary hypothyroidism in a patient with selective L-thyroxine malabsorption

We present the case of a 29-year-old woman who developed a severe hypothyroidism induced by a thyroxine malabsorption and a secondary pituitary hyperplasia. We performed thyroxine absorption tests to diagnose the malabsorption and to evaluate the best therapeutic intervention. Once assessed a correct therapy lowering TSH, we observed the regression of pituitary mass confirming our diagnosis of secondary pituitary hyperplasia. We suggest to evaluate any possible reason for thyroxine malabsorption and to consider the hypothesis of pituitary hyperplasia in the presence of pituitary mass together with overt hypothyroidism

Clonal Composition of Human Adrenocortical Neoplasms

The mechanisms of tumorigenesis of adrenocortical neoplasms are still not understood. Tumor formation may be the result of spontaneous transformation of adrenocortical cells by somatic mutations. Another factor stimulating adrenocortical cell growth and potentially associated with formation of adrenal adenomas and, less frequently, carcinomas is the chronic elevation of proopiomelanocortin-derived peptides in diseases like ACTH-dependent Cushing's syndrome and congenital adrenal hyperplasia. To further investigate the pathogenesis of adrenocortical neoplasms, we studied the clonal composition of such tumors using X-chromosome inactivation analysis of the highly polymorphic region Xcen-Xp11.4 with the hybridization probe M27ß, which maps to a variable number of tandem repeats on the X-chromsome. In addition, polymerase chain reaction amplification of a phosphoglycerokinase gene polymorphism was performed. After DNA extraction from tumorous adrenal tissue and normal leukocytes in parallel, the active X-chromosome of each sample was digested with the methylation-sensitive restriction enzyme HpaII. A second digestion with an appropriate restriction enzyme revealed the polymorphism of the region Xcen-Xp11.4 and the phosphoglycerokinase locus. Whereas in normal polyclonal tissue both the paternal and maternal alleles are detected, a monoclonal tumor shows only one of the parental alleles. A total of 21 female patients with adrenal lesions were analyzed; 17 turned out to be heterozygous for at least one of the loci. Our results were as follows: diffuse (n = 4) and nodular (n = 1) adrenal hyperplasia in patients with ACTH-dependent Cushing's syndrome, polyclonal pattern; adrenocortical adenomas (n = 8), monoclonal (n = 7), as well as polyclonal (n = 1); adrenal carcinomas (n = 3), monoclonal pattern. One metastasis of an adrenocortical carcinoma showed a pattern most likely due to tumor-associated loss of methylation. In the special case of a patient with bilateral ACTH-independent macronodular hyperplasia, diffuse hyperplastic areas and a small nodule showed a polyclonal pattern, whereas a large nodule was monoclonal. We conclude that most adrenal adenomas and carcinomas are monoclonal, whereas diffuse and nodular adrenal hyperplasias are polyclonal. The clonal composition of ACTH-independent massive macronodular hyperplasia seems to be heterogeneous, consisting of polyclonal and monoclonal areas

A Combination of Two Human Monoclonal Antibodies Limits Fetal Damage by Zika Virus in Macaques

Human infection by Zika virus (ZIKV) during pregnancy can lead to vertical transmission and fetal aberrations, including microcephaly. Prophylactic administration of antibodies can diminish or prevent ZIKV infection in animal models, but whether passive immunization can protect nonhuman primates and their fetuses during pregnancy has not been determined. Z004 and Z021 are neutralizing monoclonal antibodies to domain III of the envelope (EDIII) of ZIKV. Together the two antibodies protect nonpregnant macaques against infection even after Fc modifications to prevent antibody-dependent enhancement in vitro (ADE) and extend their half-lives. Here we report on prophylactic co-administration of the Fc-modified antibodies to pregnant rhesus macaques challenged 3 times with ZIKV during first and second trimester. The two antibodies did not entirely eliminate maternal viremia but limited vertical transmission protecting the fetus from neurologic damage. Thus, maternal passive immunization with two antibodies to EDIII can shield primate fetuses from the harmful effects of ZIKV

Effects of balloon injury on neointimal hyperplasia in steptozotocin-induced diabetes and in hyperinsulinemic nondiabetic pancreatic islet-transplanted rats.

BACKGROUND: The mechanisms of increased neointimal hyperplasia after coronary interventions in diabetic patients are still unknown. METHODS AND RESULTS: Glucose and insulin effects on in vitro vascular smooth muscle cell (VSMC) proliferation and migration were assessed. The effect of balloon injury on neointimal hyperplasia was studied in streptozotocin-induced diabetic rats with or without adjunct insulin therapy. To study the effect of balloon injury in nondiabetic rats with hyperinsulinemia, pancreatic islets were transplanted under the kidney capsule in normal rats. Glucose did not increase VSMC proliferation and migration in vitro. In contrast, insulin induced a significant increase in VSMC proliferation and migration in cell cultures. Furthermore, in VSMC culture, insulin increased MAPK activation. A reduction in neointimal hyperplasia was consistently documented after vascular injury in hyperglycemic streptozotocin-induced diabetic rats. Insulin therapy significantly increased neointimal hyperplasia in these rats. This effect of hyperinsulinemia was totally abolished by transfection on the arterial wall of the N17H-ras-negative mutant gene. Finally, after experimental balloon angioplasty in hyperinsulinemic nondiabetic islet-transplanted rats, a significant increase in neointimal hyperplasia was observed. CONCLUSIONS: In rats with streptozotocin-induced diabetes, balloon injury was not associated with an increase in neointimal formation. Exogenous insulin administration in diabetic rats and islet transplantation in nondiabetic rats increased both blood insulin levels and neointimal hyperplasia after balloon injury. Hyperinsulinemia through activation of the ras/MAPK pathway, rather than hyperglycemia per se, seems to be of crucial importance in determining the exaggerated neointimal hyperplasia after balloon angioplasty in diabetic animals

Fos co-operation with PTEN loss elicits keratoacanthoma not carcinoma due to p53/p21^WAF-induced differentiation triggered by GSK3b inactivation and reduced AKT activity

To investigate gene synergism in multistage skin carcinogenesis, the RU486-inducible cre/lox system was employed to ablate PTEN function [K14.cre/D5PTENflx] in mouse epidermis expressing activated v-fos [HK1.fos]. RU486-treated HK1.fos/D5PTENflx mice exhibited hyperplasia, hyperkeratosis and tumours that progressed to highly differentiated keratoacanthomas rather than carcinomas, due to re-expression of high p53 and p21WAF levels. Despite elevated MAP kinase activity, cyclin D1/E2 over expression and increased AKT activity forming areas of highly proliferative, papillomatous keratinocytes, increasing levels of GSK3b inactivation exceeded a threshold that induced p53/p21WAF expression to halt proliferation and accelerate differentiation, giving the hallmark keratosis of keratoacanthomas. A pivotal facet to this GSK3b-triggered mechanism centred on increasing p53 expression in basal layer keratinocytes. This reduced activated AKT expression and released inhibition of p21WAF, which accelerated keratinocyte differentiation, as indicated by unique basal layer expression of differentiation-specific keratin K1, alongside premature filaggrin and loricrin expression. Thus, fos synergism with PTEN loss elicited a benign tumour context where GSK3b-induced, p53/p21WAF expression continually switched AKT-associated proliferation into one of differentiation, preventing further progression. This putative compensatory mechanism required the critical availability of normal p53 and/or p21WAF otherwise deregulated fos, Akt and GSK3b associate with malignant progression

Silodosin inhibits noradrenaline-activated transcription factors Elk1 and SRF in human prostate smooth muscle.

The transcription factors Elk1 and serum response factor (SRF) are central regulators of cell cycle and phenotype in various cell types. Elk1 is activated by phosphorylation (serine-383), while activation of SRF requires its co-factor, myocardin. Activation of Elk1 and SRF results in binding to specific DNA sequences in promoter regions, and may be induced by adrenergic receptor activation in different organs. To examine the effects of adrenergic stimulation on Elk1 and SRF in the human prostate and the ability of the highly selective α1A-adrenoceptor antagonist, silodosin, on transcription factor activation. Prostate tissue was obtained from patients undergoing radical prostatectomy. Expression of Elk1, SRF, and myocardin was estimated by Western blot and immunohistochemistry. Colocalizations were studied by double immunofluorescence staining. Noradrenaline- (NA-) and phenylephrine- (PE-) induced phosphorylation of Elk1 was assessed by Western blot analysis using a phospho-specific antibody. NA-induced activation of Elk1 and SRF was investigated by electrophoretic mobility shift assay (EMSA). Immunoreactivity for Elk1, SRF, and myocardin was observed in stromal cells of tissues from each patient. In fluorescence stainings, SRF colocalized with myocardin and α-smooth muscle actin (αSMA). Stimulation of prostate tissues with PE (10 µM) or NA (30 µM) increased the phosphorylation of Elk1 at serine-383. NA-induced Elk1 activation was confirmed by EMSA, where a NA-induced binding of Elk1 to the DNA sequence TTTGCAAAATGCAGGAATTGTTTTCACAGT was observed. Similarly, NA caused SRF binding to the SRF-specific DNA sequence CCATATTAGGCCATATTAGG. Application of silodosin (3 µM) to prostate tissues reduced the activity of Elk1 and SRF in NA-stimulated tissues. Silodosin blocks the activation of the two transcription factors, Elk1 and SRF, which is induced by noradrenaline in the human prostate. A role of α1-adrenoceptors beyond smooth muscle contraction may be considered, which includes a function in transcriptional regulation

Angiolymphoid hyperplasia with eosinophilia treated with Mohs micrographic surgery

A 60-year-old healthy man presented with several enlarging, tender, spontaneously bleeding, and episodically pruritic nodules on his ear. Five agminated pink-red papulonodules of the superior postauricular sulcus were noted on examination. Pathological examination revealed a lobular dermal vascular proliferation with plump endothelial cells protruding into the lumen in a hobnail pattern, along with a dense perivascular inflammatory infiltrate composed of plasma cells, lymphocytes, and numerous eosinophils. The diagnosis of angiolymphoid hyperplasia with eosinophilia was confirmed. After discussing treatment modalities, the patient opted for Mohs micrographic surgery (MMS). Three stages of MMS were able to remove all large vessel involvement and clear the peripheral margins, but the tumor had a complex branching pattern of growth in the deep bed of the wound with numerous tiny foci remaining. Owing to risk of disfigurement, no further excision was undertaken. The area was reconstructed with a temporalis fascia flap and a full-thickness skin graft. Despite remaining microscopic disease, the patient remained without recurrence or symptoms at one year of follow up

Endocervical glandular neoplasia associated with lobular endocervical glandular hyperplasia is HPV-independent and correlates with carbonic anhydrase-IX expression: a Gynaecological Oncology Group Study.

BackgroundLobular endocervical glandular hyperplasia (LEGH) is a rare lesion of the uterine cervix. It has been proposed that LEGH may represent a precursor lesion to a group of mucinous adenocarcinoma with gastric phenotype (GA) that is independent of high-risk human papillomavirus (H-HPV) infection. Carbonic anhydrase-IX (CA-IX) is highly expressed in conventional glandular lesions (CGLs). However, expression of CA-IX in LEGH or GA has not been studied.MethodsIn all, 12 CGLs, 7 LEGHs, 6 LEGHs with coexisting adenocarcinoma in situ (AIS, 3) and GA (3) were identified from Japanese women with a cytological diagnosis of atypical glandular cells of undetermined significance. Immunostaining was used to detect CA-IX and p16(INK)4(a) (hereafter termed p16) protein expression in the tissues and CA-IX protein expression in the Papanicolaou smears (PSs). Polymerase chain reaction was used to detect H-HPV DNA in liquid-based cytology.ResultsOut of 12 (83%) CGLs, 10 were positive with H-HPV and high levels of CA-IX expression were seen in all (100%) cases. P16 protein expression was observed in 11 out of 12 (92%) cases. None of the LEGHs, LEGHs with AIS or GA were positive for H-HPV and only 8 out of 13 (62%) showed focal weak (1+) p16 expression. In contrast, all cases (100%) exhibited strong CA-IX protein expression.ConclusionOur study suggests that there are different molecular mechanisms of carcinogenesis resulting in CGLs vs LEGHs associated with AIS or GA. There is also a possible link between LEGHs and GAs. Furthermore, CA-IX expression may serve as a useful biomarker for the detection of GAs in the absence of H-HPV infection