Characterisation of Mitochondrial 12s rRNA Gene of Yellow Striped Chevrotain (Moschiola kathygre) and Development of a PCR-RFLP marker for the Unambiguous Identification of the Species

In the evolutionary studies of mammals, the study of Tragulids, commonly known as Chevrotains or mouse deer, is very important since they represent the basal branch of ruminants. They are the only members of the infraorder Tragulina and have not undergone significant changes since the Miocene period. Most of the Tragulids have become extinct leaving three genera to be found at present including, Tragulus, Hyemoschus, and Moschiola. The genus Moschiola consists of three species that can be found both in India (M. indica) and Sri Lanka (M. meminna and M. kathygre). The complete mitochondrial genome of Indian mouse deer has been sequenced recently but Sri Lankan mouse deer lacks molecular information. In the present study, the mitochondrial 12s rRNA gene sequence of Yellow striped Chevrotain (M. kathygre) was analysed with the objective of formulating a marker for the identification of the species. The genomic DNA from hair follicles was isolated and the 12s rRNA mitochondrial region was amplified using universal primers, forward primer 5’CAAACTGGGATTAGATACCCCACTAT 3’and reverse primer 5’GAGGGTGACGGGCGGTGTGT 3’. The sequence was compared with other deer species and the Indian Chevrotain. The Sri Lankan yellow striped chevrotain shared the highest sequence similarity of 91.19% with the Indian Chevrotain and above 89% similarity with other deer species. In silico analysis of 12s rRNA gene sequence revealed that a PCR-RFLP approach can be used to differentiate Yellow striped Chevrotain from the Indian Chevrotain using RsaI, BsrI, DraI and HinfI restriction enzymes.Keywords: Yellow striped chevrotain, Tragulids, 12s rRNA gene, PCR-RFL

Visual Techniques for the Determination of Age and Sex of Sambar Deer (Rusa unicolor unicolor) in Horton Plains National Park, Sri Lanka

A standard table was developed to facilitate the unambiguous identification of growth stages and gender of sambar deer (Rusa unicolor unicolor) calves from newborn to one year in Horton plains national park, Sri Lanka (HPNP). This was developed by evaluating the phenotypic characteristics of sambar deer calves (n=97±34) of known growth stages in 2018. A standard table was prepared based on their sex, shape of the snout, shape of the head and forehead between ears, size of the ears for the face, size of the neck, shape of the body, shape of the belly, shape of the back, size of the body and the behavior. The accuracy of the table was tested by using experienced people (n=30) who are regular visitors at HPNP. The average number of sambar deer in HPNP grassland in year 2018, during the study period was 919. In new born calves the accuracy of identification of gender was 83% and the accuracy of identification of growth phase was 87%. Identification of both sex and the growth phase of newborn calves simultaneously was 77% accurate. When the calves reach two weeks from birth, the accuracy of identifying their sex was increased to 93% whereas their growth phase was identified with 90% accuracy. The accuracy of identifying both sex and the growth phase simultaneously was 83% in calves two weeks after birth. When the calves reached five months from calving, the accuracy of identification of both sex and the growth phase increased to 100%. Calves at six months age, the identification of growth phase was 97% accurate. Accuracy of identifying of both gender and the growth phase simultaneously was 97%. In the sample between six months and one year the accuracy of identification of gender and growth phase was 95%. Starting from newborn stage to six months of age, the accuracy of identification based on the characters of the standard table increased steadily. However, upon reaching six months, there was a declination of identifying both gender and the growth phase of the sambar deer in HPNP simultaneously.Keywords: Sambar deer calves, Gender, Growth phase, Horton Plain

The pandemic brain: Neuroinflammation in non-infected individuals during the COVID-19 pandemic

While COVID-19 research has seen an explosion in the literature, the impact of pandemic-related societal and lifestyle disruptions on brain health among the uninfected remains underexplored. However, a global increase in the prevalence of fatigue, brain fog, depression and other “sickness behavior”-like symptoms implicates a possible dysregulation in neuroimmune mechanisms even among those never infected by the virus. We compared fifty-seven ‘Pre-Pandemic’ and fifteen ‘Pandemic’ datasets from individuals originally enrolled as control subjects for various completed, or ongoing, research studies available in our records, with a confirmed negative test for SARS-CoV-2 antibodies. We used a combination of multimodal molecular brain imaging (simultaneous positron emission tomography / magnetic resonance spectroscopy), behavioral measurements, imaging transcriptomics and serum testing to uncover links between pandemic-related stressors and neuroinflammation. Healthy individuals examined after the enforcement of 2020 lockdown/stay-at-home measures demonstrated elevated brain levels of two independent neuroinflammatory markers (the 18 kDa translocator protein, TSPO, and myoinositol) compared to pre-lockdown subjects. The serum levels of two inflammatory markers (interleukin-16 and monocyte chemoattractant protein-1) were also elevated, although these effects did not reach statistical significance after correcting for multiple comparisons. Subjects endorsing higher symptom burden showed higher TSPO signal in the hippocampus (mood alteration, mental fatigue), intraparietal sulcus and precuneus (physical fatigue), compared to those reporting little/no symptoms. Post-lockdown TSPO signal changes were spatially aligned with the constitutive expression of several genes involved in immune/neuroimmune functions. This work implicates neuroimmune activation as a possible mechanism underlying the non-virally-mediated symptoms experienced by many during the COVID-19 pandemic. Future studies will be needed to corroborate and further interpret these preliminary findings

Assessing cement blocks the context of sustainable construction

The task of assessing cement blocks represents an important strategy in the sustainable design and construction of a building. A principal challenge is the identification of assessment criteria based on the concepts and principles of sustainability, and the process of prioritizing and aggregating relevant criteria into an assessment framework .Therefore, the purpose of this study is to fill these gaps by describing the development stages of key assessment criteria used within an assessment tool under development for sustainable CB in the building industry. After conducting a thorough and systematic literature review, a total of 24 sustainability assessment criteria based on the triple bottom line and the needs of building stakeholders were identified. A survey of engineers and architects was conducted to capture their perceptions on the importance of the criteria. Survey questionnaires were randomly mailed and handed over to 231 engineers and 110 architects. Ninety eight (98) effective responses were received, after removing the invalid ones. The response rate was 28.7 per cent. Factor analysis was utilized to group the criteria into assessment factors for modelling sustainability of CB. Ranking analysis revealed that all criteria were highlighted at “high” or “high-medium” levels in selecting cement block building material. A total of 12 criteria was highlighted at the “high” importance level, with aesthetics, embodied energy and initial acquisition cost to make the top three criteria of importance. After the literature review, questionnaire survey and expertise opinion, the top criterion is the embodied energy. The second high criterion is the aesthetics and the third top criterion is the initial acquisition cost of CB. Factor analysis shows that these SACs can be aggregated into six factors, namely; “ environmental impacts”, “resource efficiency”, “waste minimization”, “life cycle cost”, “social benefit”, and “performance capability”. Since these criteria were derived from the survey through expert opinion, consideration of these six criteria in sustainable block making processes and products will ensure sustainability of building projects. According to the six criteria in the cement block material selection, the environmental issues are not strongly considered, despite the need of reducing the environmental impact of building activities. Hence the result is an example of evidence pointing to the trend that environmental aspects are no longer the least important factors for cement block material selection in building projects. The current study contributes to the building industry and sustainability research in at least two aspects. First, it widens the understanding of the degree of importance of sustainable CB making processes and products. It also provides building stakeholders a new way to select CB, thereby facilitating the sustainability of building projects