328 research outputs found
Role of mitochondria in the pheromone- and amiodarone-induced programmed death of yeast
Although programmed cell death (PCD) is extensively studied in multicellular organisms, in recent years it has been shown that a unicellular organism, yeast Saccharomyces cerevisiae, also possesses death program(s). In particular, we have found that a high doses of yeast pheromone is a natural stimulus inducing PCD. Here, we show that the death cascades triggered by pheromone and by a drug amiodarone are very similar. We focused on the role of mitochondria during the pheromone/amiodarone-induced PCD. For the first time, a functional chain of the mitochondria-related events required for a particular case of yeast PCD has been revealed: an enhancement of mitochondrial respiration and of its energy coupling, a strong increase of mitochondrial membrane potential, both events triggered by the rise of cytoplasmic [Ca2+], a burst in generation of reactive oxygen species in center o of the respiratory chain complex III, mitochondrial thread-grain transition, and cytochrome c release from mitochondria. A novel mitochondrial protein required for thread-grain transition is identified
Death receptors: New opportunities in cancer therapy
© 2017 Park-media, Ltd. This article offers a detailed review of the current approaches to anticancer therapy that target the death receptors of malignant cells. Here, we provide a comprehensive overview of the structure and function of death receptors and their ligands, describe the current and latest trends in the development of death receptor agonists, and perform their comparative analysis. In addition, we discuss the DR4 and DR5 agonistic antibodies that are being evaluated at various stages of clinical trials. Finally, we conclude by stating that death receptor agonists may be improved through increasing their stability, solubility, and elimination half-life, as well as by overcoming the resistance of tumor cells. What's more, effective application of these antibodies requires a more detailed study of their use in combination with other anticancer agents
Conjugates of Phthalocyanines With Oligonucleotides as Reagents for Sensitized or Catalytic DNA Modification
Several conjugates of metallophthalocyanines with deoxyribooligonucleotides were synthesized to investigate sequence-specific modification of DNA by them. Oligonucleotide parts of these conjugates were responsible for the recognition of selected complementary sequences on the DNA target. Metallophthalocyanines were able to induce the DNA modification: phthalocyanines of Zn(II) and Al(III) were active as photosensitizers in the generation of singlet oxygen (1)O(2), while phthalocyanine of Co(II) promoted DNA oxidation by molecular oxygen through the catalysis of formation of reactive oxygen species ((.)O(2)(−), H(2)O(2), OH). Irradiation of the reaction mixture containing either Zn(II)- or Al(III)-tetracarboxyphthalocyanine conjugates of oligonucleotide pd(TCTTCCCA) with light of > 340 nm wavelength (Hg lamp or He/Ne laser) resulted in the modification of the 22-nucleotide target d(TGAATGGGAAGAGGGTCAGGTT). A conjugate of Co(II)-tetracarboxyphthalocyanine with the oligonucleotide was found to modify the DNA target in the presence of O(2) and 2-mercaptoethanol or in the presence of H(2)O(2). Under both sensitized and catalyzed conditions, the nucleotides G(13)–G(15) were mainly modified, providing evidence that the reaction proceeded in the double-stranded oligonucleotide. These results suggest the possible use of phthalocyanine-oligonucleotide conjugates as novel artificial regulators of gene expression and therapeutic agents for treatment of cancer
Deimination of the myelin basic protein decelerates its proteasome-mediated metabolism
© 2016, Pleiades Publishing, Ltd.Deimination of myelin basic protein (MBP) by peptidylarginine deiminase (PAD) prevents its binding to the proteasome and decelerates its degradation by the proteasome in mammalian cells. Potential anticancer drug tetrazole analogue of chloramidine 2, at concentrations greater than 1 µM inhibits the enzymatic activity of PAD in vitro. The observed acceleration of proteasome hydrolysis of MBP to antigenic peptides in the presence of PAD inhibitor may increase the efficiency of lesion of the central nervous system by cytotoxic lymphocytes in multiple sclerosis. We therefore suggest that clinical trials and the introduction of PAD inhibitors in clinical practice for the treatment of malignant neoplasms should be performed only after a careful analysis of their potential effect on the induction of autoimmune neurodegeneration processes
Tyrosol induces multiple drug resistance in yeast Saccharomyces cerevisiae
In yeast, multiple (pleiotropic) drug resistance (MDR) transporters efflux xenobiotics from the cytoplasm to the environment. Additionally, upon the accumulation of xenobiotics in the cells, MDR genes are induced. At the same time, fungal cells can produce secondary metabolites with physico-chemical properties similar to MDR transporter substrates. Nitrogen limitation in yeast Saccharomyces cerevisiae leads to the accumulation of phenylethanol, tryptophol, and tyrosol, which are products of aromatic amino acid catabolism. In this study, we investigated whether these compounds could induce or inhibit MDR in yeast. Double deletion of PDR1 and PDR3 genes, which are transcription factors that upregulate the expression of PDR genes, reduced yeast resistance to high concentrations of tyrosol (4–6 g/L) but not to the other two tested aromatic alcohols. PDR5 gene, but not other tested MDR transporter genes (SNQ2, YOR1, PDR10, PDR15) contributed to yeast resistance to tyrosol. Tyrosol inhibited the efflux of rhodamine 6G (R6G), a substrate for MDR transporters. However, preincubating yeast cells with tyrosol induced MDR, as evidenced by increased Pdr5-GFP levels and reduced yeast ability to accumulate Nile red, another fluorescent MDR-transporter substrate. Moreover, tyrosol inhibited the cytostatic effect of clotrimazole, the azole antifungal. Our results demonstrate that a natural secondary metabolite can modulate yeast MDR. We speculate that intermediates of aromatic amino acid metabolites coordinate cell metabolism and defense mechanisms against xenobiotics
Modelling of the receptor-ligand interaction in a single cell mode
Membrane-associated intrareceptoral and ligand-receptor interactions are involved in intracellular signalling. Community of surface receptors represents extremely important target for modern therapeutics. Their developing evidently requires elaboration of effective screening platforms. In this study we suggest universal platform designed to test receptor-ligand interaction in a "single cell" mode. For this purpose we created a DNA vector utilizing modular structure of chimeric receptors. The whole platform was tested using myc peptide - anti-myc antibody counterpart, which is directly linked with regulation of cancer cell development. In this study we succeeded to obtain Jurkat cells transduced with cDNA coding for chimeric antigenic receptor containing extracellular scFv of the myc-specific antibody and human Fc fused with transmembrane anchor. We showed that chimeric receptor interacts with myc peptide in a "single cell" mode, which in turn leads to the activation of T cells. We further suggest that designed system can be used for any other receptor-ligand pair to detect their interaction directly on the cell surface. Elaborated platform may be applied for the widerange screening of the agents with therapeutic potential on the cell membrane ex vivo
- …