Cross-disciplinary collaboration through WuZhiQiao Project to foster cultural exchange and community engagement

In 2013, students of the Technological and Higher Education Institute of Hong Kong (THEi), with the support of WuZhiQiao (WZQ) Charitable Foundation, formed a core team of 11 students to organize and participate in social service projects to help the underprivileged in the Chinese mainland. WuZhiQiao (WZQ) projects, the first cross-region social service engagement by THEi students, bring together students from Hong Kong and the Mainland. WZQ Charitable Foundation aims to help the Chinese traditional village in building Pedestrian Bridge and organizing community projects. Since there are Chinese villages facing flooding during rainy seasons, the local villagers will be trapped inside the village without the chance to go outside or wade outside the village. There are hundreds of such villages and they highly need our help. Each project mainly involves two or three institutes from Hong Kong and the Mainland, and they organize the whole volunteer project including planning, investigation, design, promotion and operation. Through involvement in different states or provinces, WZQ projects provide good chance of communication and interaction between Hong Kong teams and the Mainland teams and advocate intercultural social services. The projects can foster the cultural exchange between Hong Kong and the Mainland. Moreover, the majority of WZQ project members are coming from the fields of engineering, architecture and health care. We can practice our learning from lectures through the project implementation. Different parties are involved in the engineering projects including clients, consultants, contractors, surveyors, engineers and workers. Engineering students can gain good understanding of the holistic picture of a real-life engineering project. We visited the location village for investigation to learn more about the local culture, geometry and the people’s needs and discussed with the Mainland Team through online chatting tools in order to propose the optimal pedestrian building design and other community projects. Having spent over six months in planning and preparation, THEi students will implement a bridge-building and community project in Chongqing in January 2015. Through engagement in this service-learning project, not only the undergraduates of THEi can benefit through personal development but the life quality of the disadvantaged can also be improved

Efficacy, safety and immunogenicity of a human rotavirus vaccine (RIX4414) in Hong Kong children up to three years of age: A randomized, controlled trial

AbstractBackgroundA phase III, double-blind, randomized, controlled trial was conducted in Hong Kong to evaluate the efficacy, safety and immunogenicity of a human rotavirus vaccine, RIX4414 (Rotarix™) against severe rotavirus gastroenteritis in children up to three years of age.MethodsHealthy infants aged 6–12 weeks were enrolled between 08-December-2003 and 31-August-2005 and received two oral doses of either RIX4414 vaccine (N=1513) or placebo (N=1512) given 2 months apart. Vaccine efficacy was assessed from two weeks post-Dose 2 until the children were two and three years of age. Anti-rotavirus IgA seroconversion rate was calculated pre-vaccination and 1–2 months post-Dose 2 using ELISA (cut-off=20U/mL) for 100 infants. Safety was assessed until the children were two years of age; serious adverse events (SAEs) were recorded throughout the study period.ResultsIn children aged two and three years of life, vaccine efficacy against severe rotavirus gastroenteritis was 95.6% (95% CI: 73.1%–99.9%) and 96.1% (95% CI: 76.5%–99.9%), respectively. The seroconversion rate 1–2 months after the second dose of RIX4414 was 97.5% (95% CI: 86.8%–99.9%). At least one SAE was recorded in 439 and 477 infants who were administered RIX4414 and placebo, respectively (p-value=0.130). Six intussusception cases were reported (RIX4414=4; placebo=2) and none was assessed to be vaccine-related.ConclusionRIX4414 was efficacious, immunogenic and safe in the prevention of rotavirus gastroenteritis for at least two years post-vaccination in Hong Kong children

MicroRNA-145 Regulates Human Corneal Epithelial Differentiation

Epigenetic factors, such as microRNAs, are important regulators in the self-renewal and differentiation of stem cells and progenies. Here we investigated the microRNAs expressed in human limbal-peripheral corneal (LPC) epithelia containing corneal epithelial progenitor cells (CEPCs) and early transit amplifying cells, and their role in corneal epithelium.Human LPC epithelia was extracted for small RNAs or dissociated for CEPC culture. By Agilent Human microRNA Microarray V2 platform and GeneSpring GX11.0 analysis, we found differential expression of 18 microRNAs against central corneal (CC) epithelia, which were devoid of CEPCs. Among them, miR-184 was up-regulated in CC epithelia, similar to reported finding. Cluster miR-143/145 was expressed strongly in LPC but weakly in CC epithelia (P = 0.0004, Mann-Whitney U-test). This was validated by quantitative polymerase chain reaction (qPCR). Locked nucleic acid-based in situ hybridization on corneal rim cryosections showed miR-143/145 presence localized to the parabasal cells of limbal epithelium but negligible in basal and superficial epithelia. With holoclone forming ability, CEPCs transfected with lentiviral plasmid containing mature miR-145 sequence gave rise to defective epithelium in organotypic culture and had increased cytokeratin-3/12 and connexin-43 expressions and decreased ABCG2 and p63 compared with cells transfected with scrambled sequences. Global gene expression was analyzed using Agilent Whole Human Genome Oligo Microarray and GeneSpring GX11.0. With a 5-fold difference compared to cells with scrambled sequences, miR-145 up-regulated 324 genes (containing genes for immune response) and down-regulated 277 genes (containing genes for epithelial development and stem cell maintenance). As validated by qPCR and luciferase reporter assay, our results showed miR-145 suppressed integrin β8 (ITGB8) expression in both human corneal epithelial cells and primary CEPCs.We found expression of miR-143/145 cluster in human corneal epithelium. Our results also showed that miR-145 regulated the corneal epithelium formation and maintenance of epithelial integrity, via ITGB8 targeting

Antimicrobial resistance among migrants in Europe: a systematic review and meta-analysis

BACKGROUND: Rates of antimicrobial resistance (AMR) are rising globally and there is concern that increased migration is contributing to the burden of antibiotic resistance in Europe. However, the effect of migration on the burden of AMR in Europe has not yet been comprehensively examined. Therefore, we did a systematic review and meta-analysis to identify and synthesise data for AMR carriage or infection in migrants to Europe to examine differences in patterns of AMR across migrant groups and in different settings. METHODS: For this systematic review and meta-analysis, we searched MEDLINE, Embase, PubMed, and Scopus with no language restrictions from Jan 1, 2000, to Jan 18, 2017, for primary data from observational studies reporting antibacterial resistance in common bacterial pathogens among migrants to 21 European Union-15 and European Economic Area countries. To be eligible for inclusion, studies had to report data on carriage or infection with laboratory-confirmed antibiotic-resistant organisms in migrant populations. We extracted data from eligible studies and assessed quality using piloted, standardised forms. We did not examine drug resistance in tuberculosis and excluded articles solely reporting on this parameter. We also excluded articles in which migrant status was determined by ethnicity, country of birth of participants' parents, or was not defined, and articles in which data were not disaggregated by migrant status. Outcomes were carriage of or infection with antibiotic-resistant organisms. We used random-effects models to calculate the pooled prevalence of each outcome. The study protocol is registered with PROSPERO, number CRD42016043681. FINDINGS: We identified 2274 articles, of which 23 observational studies reporting on antibiotic resistance in 2319 migrants were included. The pooled prevalence of any AMR carriage or AMR infection in migrants was 25·4% (95% CI 19·1-31·8; I2 =98%), including meticillin-resistant Staphylococcus aureus (7·8%, 4·8-10·7; I2 =92%) and antibiotic-resistant Gram-negative bacteria (27·2%, 17·6-36·8; I2 =94%). The pooled prevalence of any AMR carriage or infection was higher in refugees and asylum seekers (33·0%, 18·3-47·6; I2 =98%) than in other migrant groups (6·6%, 1·8-11·3; I2 =92%). The pooled prevalence of antibiotic-resistant organisms was slightly higher in high-migrant community settings (33·1%, 11·1-55·1; I2 =96%) than in migrants in hospitals (24·3%, 16·1-32·6; I2 =98%). We did not find evidence of high rates of transmission of AMR from migrant to host populations. INTERPRETATION: Migrants are exposed to conditions favouring the emergence of drug resistance during transit and in host countries in Europe. Increased antibiotic resistance among refugees and asylum seekers and in high-migrant community settings (such as refugee camps and detention facilities) highlights the need for improved living conditions, access to health care, and initiatives to facilitate detection of and appropriate high-quality treatment for antibiotic-resistant infections during transit and in host countries. Protocols for the prevention and control of infection and for antibiotic surveillance need to be integrated in all aspects of health care, which should be accessible for all migrant groups, and should target determinants of AMR before, during, and after migration. FUNDING: UK National Institute for Health Research Imperial Biomedical Research Centre, Imperial College Healthcare Charity, the Wellcome Trust, and UK National Institute for Health Research Health Protection Research Unit in Healthcare-associated Infections and Antimictobial Resistance at Imperial College London

Robust estimation of bacterial cell count from optical density

Optical density (OD) is widely used to estimate the density of cells in liquid culture, but cannot be compared between instruments without a standardized calibration protocol and is challenging to relate to actual cell count. We address this with an interlaboratory study comparing three simple, low-cost, and highly accessible OD calibration protocols across 244 laboratories, applied to eight strains of constitutive GFP-expressing E. coli. Based on our results, we recommend calibrating OD to estimated cell count using serial dilution of silica microspheres, which produces highly precise calibration (95.5% of residuals <1.2-fold), is easily assessed for quality control, also assesses instrument effective linear range, and can be combined with fluorescence calibration to obtain units of Molecules of Equivalent Fluorescein (MEFL) per cell, allowing direct comparison and data fusion with flow cytometry measurements: in our study, fluorescence per cell measurements showed only a 1.07-fold mean difference between plate reader and flow cytometry data

Surgical site infection after gastrointestinal surgery in high-income, middle-income, and low-income countries: a prospective, international, multicentre cohort study

Background: Surgical site infection (SSI) is one of the most common infections associated with health care, but its importance as a global health priority is not fully understood. We quantified the burden of SSI after gastrointestinal surgery in countries in all parts of the world. Methods: This international, prospective, multicentre cohort study included consecutive patients undergoing elective or emergency gastrointestinal resection within 2-week time periods at any health-care facility in any country. Countries with participating centres were stratified into high-income, middle-income, and low-income groups according to the UN's Human Development Index (HDI). Data variables from the GlobalSurg 1 study and other studies that have been found to affect the likelihood of SSI were entered into risk adjustment models. The primary outcome measure was the 30-day SSI incidence (defined by US Centers for Disease Control and Prevention criteria for superficial and deep incisional SSI). Relationships with explanatory variables were examined using Bayesian multilevel logistic regression models. This trial is registered with ClinicalTrials.gov, number NCT02662231. Findings: Between Jan 4, 2016, and July 31, 2016, 13 265 records were submitted for analysis. 12 539 patients from 343 hospitals in 66 countries were included. 7339 (58·5%) patient were from high-HDI countries (193 hospitals in 30 countries), 3918 (31·2%) patients were from middle-HDI countries (82 hospitals in 18 countries), and 1282 (10·2%) patients were from low-HDI countries (68 hospitals in 18 countries). In total, 1538 (12·3%) patients had SSI within 30 days of surgery. The incidence of SSI varied between countries with high (691 [9·4%] of 7339 patients), middle (549 [14·0%] of 3918 patients), and low (298 [23·2%] of 1282) HDI (p < 0·001). The highest SSI incidence in each HDI group was after dirty surgery (102 [17·8%] of 574 patients in high-HDI countries; 74 [31·4%] of 236 patients in middle-HDI countries; 72 [39·8%] of 181 patients in low-HDI countries). Following risk factor adjustment, patients in low-HDI countries were at greatest risk of SSI (adjusted odds ratio 1·60, 95% credible interval 1·05–2·37; p=0·030). 132 (21·6%) of 610 patients with an SSI and a microbiology culture result had an infection that was resistant to the prophylactic antibiotic used. Resistant infections were detected in 49 (16·6%) of 295 patients in high-HDI countries, in 37 (19·8%) of 187 patients in middle-HDI countries, and in 46 (35·9%) of 128 patients in low-HDI countries (p < 0·001). Interpretation: Countries with a low HDI carry a disproportionately greater burden of SSI than countries with a middle or high HDI and might have higher rates of antibiotic resistance. In view of WHO recommendations on SSI prevention that highlight the absence of high-quality interventional research, urgent, pragmatic, randomised trials based in LMICs are needed to assess measures aiming to reduce this preventable complication

Bioinformatic analysis of neurofibromatosis type 1 on transcriptional regulation

The objective of this study was to identify potential transcription factor binding sites in the human NF1 gene through phylogenetic footprinting. The 5 upstream region (5UR) and Exon 1- Intron 1 of the NF1 gene from human, mouse, rat, and pufferfish were compared and analyzed using various bioinformatic tools. Three regions that have equal or higher homology than the coding regions were discovered in the NF1 5UR, and four more very highly homologous regions were found in intron 1. Five of these highly homologous regions had transcription factor binding site predictions that were similar for the two binding site detection programs used in this study. One of the highly homologous regions within intron 1 had no shared predictions between the two transcription binding site detection programs. Another highly homologous region in intron 1 is a tetranucleotide repeated sequence. One of the highly homologous regions in the 5UR that contains several transcription factor binding site predictions spans the transcription start site. This region includes a 24bp sequence acttccggtggggtgtcatggcgg 310-333 bp upstream of the translation start that is identical in human, mouse and rat and differs by onlyl bp in Fugu. This sequence may contain the core promoter responsible for NF1 transcription initiation.Medicine, Faculty ofMedical Genetics, Department ofGraduat

All-round development through multi-media project courses

We describe our experience in introducing multi-media project courses to Physics students. A feature of our scheme is the requirement for students to make presentations with multi-media aids to both university and secondary school students. The scheme was successful in providing the students with opportunities for all-round development