Antiandrogens prevent stable DNA-binding of the androgen receptor

The androgen receptor (AR) is essential for development of the male gender and in the growth of the majority of prostate cancers. Agonists as well as most antagonists induce translocation of the receptor to the nucleus, whereas only agonists can activate AR function. Antagonists are therefore used in the therapy of metastasized prostate cancer. To obtain insight into the mechanism by which antagonists block AR function in living cells, we studied nuclear mobility and localization of green fluorescent protein (GFP)-tagged AR in the presence of either the agonist R1881 or the antagonists bicalutamide and hydroxyflutamide. As controls we investigated a non-DNA-binding AR mutant (A573D) and two mutants (W741C and T877A) with broadened ligand specificity. We demonstrate that in the presence of R1881, AR localizes in numerous intranuclear foci and, using complementary fluorescence recovery after photobleaching (FRAP) approaches and computer modelling, that a fraction of AR ( approximately 10-15%) is transiently immobilized in a DNA-binding-dependent manner (individual ARs being immobile for approximately 45 seconds). By contrast, antagonist-bound GFP-AR showed no detectable immobile fraction and the mobility was similar to that of the R1881-liganded non-DNA-binding mutant (A573D), indicating that antagonists do not induce the relatively stable DNA-binding-dependent immobilization observed with agonist-bound AR. Moreover, in the presence of bicalutamide and hydroxyflutamide GFP-AR was homogeneously distributed in the nucleus. Binding of bicalutamide and hydroxyflutamide to GFP-AR(W741C) and GFP-AR(T877A), respectively, resulted in similar mobility and heterogeneous nuclear distribution as observed for R1881-liganded GFP-AR. The live cell studies indicate that the investigated antagonists interfere with events early in the transactivation function of the AR

Tissue specific and androgen-regulated expression of human prostate-specific transglutaminase

Transglutaminases (TGases) are calcium-dependent enzymes catalysing the post-translational cross-linking of proteins. In the prostate at least two TGases are present, the ubiquitously expressed tissue-type TGase (TGC), and a prostate-restricted TGase (TGP). This paper deals with the molecular cloning and characterization of the cDNA encoding the human prostate TGase (hTGP). For this purpose we have screened a human prostate cDNA library with a probe from the active-site region of TGC. The largest isolated cDNA contained an open reading frame encoding a protein of 684 amino acids with a predicted molecular mass of 77 kDa as confirmed by in vitro transcription-translation and subsequent SDS/PAGE. The hTGP gene was tissue-specifically expressed in the prostate, yielding an mRNA of approx. 3.5 kb. Furthermore, a 3-fold androgen-induced upregulation of hTGP mRNA expression has been demonstrated in the recently developed human prostate cancer cell line, PC346C. Other well established human prostate cancer cell lines, LNCaP and PC-3, showed no detectable hTGP mRNA expression on a Northern bolt. The gene coding for prostate TGase was assigned to chromosome 3

Functional interactions of the AF-2 activation domain core region of the human androgen receptor with the amino-terminal domain and with the transcriptional coactivator TIF2 (transcriptional intermediary factor2)

Previous studies in yeast and mammalian cells showed a functional interaction between the amino-terminal domain and the carboxy-terminal, ligand-binding domain (LBD) of the human androgen receptor (AR). In the present study, the AR subdomains involved in this in vivo interaction were determined in more detail. Cotransfection experiments in Chinese hamster ovary (CHO) cells and two-hybrid experiments in yeast revealed that two regions in the NH2-terminal domain are involved in the functional interaction with the LBD: an interacting domain at the very NH2 terminus, located between amino acid residues 3 and 36, and a second domain, essential for transactivation, located between residues 370 and 494. Substitution of glutamic acid by glutamine at position 888 (E888Q) in the AF-2 activation domain (AD) core region in the LBD, markedly decreased the interaction with the NH2-terminal domain. This mutation neither influenced hormone binding nor LBD homodimerization, suggesting a role of the AF-2 AD core region in the functional interaction between the NH2-terminal domain and the LBD. The AF-2 AD core region was also involved in the interaction with the coactivator TIF2 (transcriptional intermediary factor 2), as the E888Q mutation decreased the stimulatory effect of TIF2 on AR AF-2 activity. Cotransfection of TIF2 and the AR NH2-terminal domain expression vectors did not result in synergy between both factors in the induction of AR AF-2 activity. TIF2 highly induced AR AF-2 activity on a complex promoter [mouse mammary tumor virus (MMTV)], but it was hardly active on a minimal promoter (GRE-TATA). In contrast, the AR NH2-terminal domain induced AR AF-2 activity on both promoter constructs. These data indicate that both the AR NH2-terminal domain and the coactivator TIF2 functionally interact, either directly or indirectly, with the AF-2 AD core region in the AR-LBD, but the level of transcriptional response induced by TIF2 depends on the promoter context

Amino acids 3-13 and amino acids in and flanking the 23FxxLF27 motif modulate the interaction between the N-terminal and ligand-binding domain of the androgen receptor

The N-terminal domain (NTD) and the ligand-binding domain (LBD) of the androgen receptor (AR) exhibit a ligand-dependent interaction (N/C interaction). Amino acids 3-36 in the NTD (AR3-36) play a dominant role in this interaction. Previously, it has been shown that a PhixxPhiPhi motif in AR3-36, 23FxxLF27, is essential for LBD interaction. We demonstrate in the current study that AR3-36 can be subdivided into two functionally distinct fragments: AR3-13 and AR16-36. AR3-13 does not directly interact with the AR LBD, but rather contributes to the transactivation function of the AR.NTD-AR.LBD complex. AR16-36, encompassing the 23FxxLF27 motif, is predicted to fold into a long amphipathic alpha-helix. A second PhixxPhiPhi candidate protein interaction motif within the helical structure, 30VREVI34, shows no affinity to the LBD. Within AR16-36, amino acid residues in and flanking the 23FxxLF27 motif are demonstrated to modulate N/C interaction. Substitution of Q24 and N25 by alanine residues enhances N/C interaction. Substitution of amino acids flanking the 23FxxLF27 motif by alanines are inhibitory to LBD interaction

Unusual specificity of the androgen receptor in the human prostate tumor cell line LNCaP: High affinity for progestagenic and estrogenic steroids

Abstract LNCaP tumor cells, derived from a metastatic lesion of a human prostatic carcinoma, are androgen-sensitive in cell culture. Although increase in growth rate is observed with low doses of progestagens or estradiol, these cells contain exclusively androgen receptors. In the present study the binding affinity of different ligands for both non-DNA- and DNA-binding (transformed) forms of the androgen receptor were analyzed. The cytosolic (non-transformed) form of the receptor displayed an abnormal high affinity for progestagens and estradiol when compared with the cytosolic androgen receptor from other sources. Subsequently the non-transformed forms of the androgen receptor obtained from LNCaP cell nuclei was studied. A high binding affinity was found not only for dihydrotestosterone, but also for progesterone and the synthetic progestagen R5020 (relative binding affinity 42% and 10% of dihydrotestosterone). The binding characteristics of the transformed androgen receptor were examined in intact cells at 37°C. LNCaP cells were compared in this respect with COS cells containing the cloned human androgen receptor, normal human skin fibroblasts and PC3 (prostate) and NHIK (cervix) human tumor cell lines. The affinity of the transformed androgen receptors for the progestagen R5020 in LNCaP cells was significantly higher than in the other cell systems, although the differences were less pronounced than for the non-transformed receptor form. In conclusion: the LNCaP tumor cells contain an androgen receptor with an abnormal binding site. This might be due to a mutation and/or a post-transcriptional effect

Substitution of Ala564 in the first zinc cluster of the deoxyribonucleic acid (DNA)-binding domain of the androgen receptor by Asp, Asn, or Leu exerts differential effects on DNA binding

In the androgen receptor of a patient with androgen insensitivity, the alanine residue at position 564 in the first zinc cluster of the DNA-binding domain was substituted by aspartic acid. In other members of the steroid receptor family, either valine or alanine is present at the corresponding position, suggesting the importance of a neutral amino acid residue at this site. The mutant receptor was transcriptionally inactive, which corresponded to the absence of specific DNA binding in gel retardation assays, and its inactivity in a promoter interference assay. Two other receptor mutants with a mutation at this same position were created to study the role of position 564 in the human androgen receptor on DNA binding in more detail. Introduction of asparagine at position 564 resulted in transcription activation of a mouse mammary tumor virus promoter, although at a lower level compared with the wild-type receptor. Transcription activation of an (ARE)2-TATA promoter was low, and binding to different hormone response elements could not be visualized. The receptor with a leucine residue at position 564 was as active as the wild-type receptor on a mouse mammary tumor virus promoter and an (ARE)2-TATA promoter, but interacted differentially with several hormone response elements in a gel retardation assay. The results of the transcription activation and DNA binding studies could partially be predicted from three-dimensional modeling data. The phenotype of the patient was explained by the negative charge, introduced at position 564

Transcriptional regulation of androgen receptor gene expression in Sertoli cells and other cell types

Cooperative actions of FSH and androgens on initiation, maintenance, and restoration of spermatogenesis have been described. In the present experiments the regulatory effects of FSH on androgen receptor (AR) gene expression in Sertoli cells were studied. In immature rats injection of FSH (1 microgram/g BW, ip) resulted in a rapid down-regulation of testicular AR mRNA expression (4 h), followed by recovery to the control level (10 h). Using cultured immature Sertoli cells, a similar transient effect on AR mRNA expression was observed after the addition of FSH (500 ng/ml) or (Bu)2cAMP (0.5 mM). Cycloheximide treatment of the cells did not prevent the rapid FSH-induced down-regulation of AR mRNA expression, indicating that de novo protein synthesis is not required for this effect. Furthermore, using a transcriptional run-on assay, no marked decrease in the rate of AR gene transcription was found upon treatment of the cultured Sertoli cells with FSH for 2 or 4 h. This demonstrates that the short term effect of FSH or AR mRNA expression reflects a change in mRNA stability. The AR protein level was not markedly affected by the transient decrease in AR mRNA expression. When immature Sertoli cells were incubated with FSH for longer time periods (24-72 h), both AR mRNA and protein expression were increased. In Sertoli cells isolated from 15-day-old rats, this increase was higher (mRNA, 2- to 3-fold; protein, 2-fold) than in Sertoli cell

Two androgen response regions cooperate in steroid hormone regulated activity of the prostate-specific antigen promoter

Transcription of the prostate-specific antigen (PSA) gene is androgen regulated. The PSA promoter contains at position -170 the sequence AGAACAgcaAGTGCT, which is closely related to the ARE (androgen response element) consensus sequence GGTACAnnnTGTTCT. This sequence is a high affinity androgen receptor (AR) binding site and acts as a functional ARE in transfected LNCaP cells. A 35-base pair segment starting at -400 (ARR: androgen response region; GTGGTGCAGGGATCAGGGAGTCTCACAATCTCCTG) cooperates with the ARE in androgen induction of the PSA promoter. A construct with three ARR copies linked to a minimal PSA promoter showed a strong (104-fold) androgen induced activity. The ARR was also able to confer androgen responsiveness to a minimal thymidine kinase promoter. Both AR binding and transcriptional activity resided in a 20-base pair ARR subfragment: CAGGGATCAGGGAGTCTCAC (2S). Mutational analysis indicated that the sequence GGATCAgggAGTCTC in the 2S fragment is a functionally active, low affinity AR binding site. Like AR, the glucocorticoid receptor was able to stimulate PSA promoter activity. Both the ARE and ARR are involved in dexamethasone regulation of the PSA promoter. Both the AR and glucocorticoid receptor were 20-100-fold more active on ARR-PSA and ARR-thymidine kinase promoter constructs in LNCaP cells than in other cell types (COS, HeLa, Hep3B, and T47D cells), indicating (prostate) cell specificity

Both androgen receptor and glucocorticoid receptor are able to induce prostate-specific antigen expression, but differ in their growth-stimulating properties of LNCaP cells

Androgen receptor-positive LNCaP cells were stably transfected with a rat glucocorticoid receptor (GR) expression plasmid. Ligand-binding studies in the generated cell lines revealed high-affinity binding of the cognate ligands to their receptors. Transfection experiments with the newly derived cell lines showed that, like androgen receptor, GR can induce activity of a prostate-specific antigen promoter fragment linked to the luciferase gene. Similarly, dexamethasone can stimulate expression of endogenous prostate-specific antigen messenger RNA. Cell proliferation could be induced by R1881. In contrast, dexamethasone treatment of the GR-positive sublines had no stimulatory effect on cell growth. Using the differential display technique, a so far unknown complementary DNA fragment, designated 21.1, specifically induced by androgens and not by glucocorticoids, has been identified. In conclusion, the newly generated cell lines, together with the parental LNCaP cell line, form an attractive system with which to study the mechanism of specificity of steroid hormone regulation of gene expression