DNA regions essential for the function of a bacteriophage fd promoter.

The promoter for the major coat protein gene of bacteriophage fd contains a unique sequence. TATAAT, in the non-transcribed region corresponding to the Pribnow box. A R-Hha I cleavage site which destroys functions is located five pairs upstream from the TATAAT sequence (fifteen base pairs upstream from the RNA initiation site). The promoter was cleaved into two fragments by R-Hha I and each promoter fragment was joined to DNA fragments derived from other regions. Ligation of the TATAAT-containing fragment to any of the DNA fragments examined resulted in recovery of promoter function. The results suggest for this type of promoter that no unique sequence is necessary upstream from the R-Hha I cleavage site although a contiguous DNA chain must be present in this area

Studies on bacteriophage fd DNA. III. Nucleotide sequence preceding the RNA start-site on a promoter-containing fragment.

A short DNA fragment containing a strong promoter was isolated from phage fd replicative form DNA with the use of restriction endonucleases, and the sequence of 110 nucleotides in the region preceding the RNA start-site was determined. The sequence was : (5') CGGTCTGGTTCGCTTTGAGGCTCGAATTAAAACGCGATATTTGAAGTCTTTCGGGCTTCCTCTTAATCTTTTTGATCGAATTCGCTTTGCTTCTGACTATAATAGACAGG (3')

Nucleotide sequence of bacteriophage fd DNA.

The sequence of the 6,408 nucleotides of bacteriophage fd DNA has been determined. This allows to deduce the exact organisation of the filamentous phage genome and provides easy access to DNA segments of known structure and function