Rectal gel application of Withania somnifera root extract expounds anti-inflammatory and muco-restorative activity in TNBS-induced Inflammatory Bowel Disease

<p>Abstract</p> <p>Background</p> <p>Inflammatory Bowel Disease (IBD) is marked with chronic inflammation of intestinal epithelium driven by oxidative stress. Traditional treatments with plant extracts gained renewed interest due to their ability to ameliorate the multi factorial conditions like inflammation. We investigated the beneficial effects of <it>Withania somnifera </it>in Trinitro Benzyl Sulfonic Acid (TNBS) induced experimental IBD through a rectally applicable formulation.</p> <p>Methods</p> <p>The study included (i) preparation of gel formulation from aqueous <it>Withania somnifera </it>root extract (WSRE), (ii) biochemical assays to determine its performance potential, (iii) testing of formulation efficacy in TNBS-induced IBD rat model, and (iv) histo-patholgical studies to assess its healing and muco-regenerative effect in IBD-induced rats. For this purpose, concentration dependant antioxidant activity of the extracts were evaluated using biochemical assays like (a) inhibition of lipid peroxidation, (b) NO scavenging, (c) H₂O₂scavenging, and (d) ferric reducing power assay.</p> <p>Results</p> <p>The extract, at 500 μg/ml, the highest concentration tested, showed 95.6% inhibition of lipid peroxidation, 14.8% NO scavenging, 81.79% H₂O₂scavenging and a reducing capacity of 0.80. The results were comparable with standard antioxidants, ascorbic acid and curcumin. WSRE treatment positively scored on histopathological parameters like necrosis, edema, neutrophil infiltration. The post treatment intestinal features showed restoration at par with the healthy intestine. In view of these results, gel formulation containing an aqueous extract of <it>W. somnifera</it>, prepared for rectal application was tested for its anti-inflammatory activity in TNBS-induced rat models for IBD. Commercially available anti-inflammatory drug Mesalamine was used as the standard in this assay.</p> <p>Conclusions</p> <p>Dose of the rectal gel applied at 1000 mg of WSRE per kg rat weight showed significant muco-restorative efficacy in the IBD-induced rats, validated by histo-pathological studies.</p

Antioksidativni potencijal i sposobnost hvatanja slobodnih radikala metanolnog ekstrakta plodova Citrullus colocynthis (L.) Schrad.

Citrullus colocynthis (L.) Schrad. (Cucurbitaceae) is a medicinal plant traditionally used as an abortifacient and to treat constipation, oedema, bacterial infections, cancer and diabetes. Preliminary phytochemical screening of the plant showed the presence of large amounts of phenolics and flavonoids. Subsequent quantification showed the presence of 0.74% phenolics (calculated as gallic acid) and 0.13% flavonoids calculated as catechin equivalents per 100 g of fresh mass. The presence of phenolic compounds prompted us to evaluate its antioxidant activity. In the present study, methanolic fruit extract of C. colocynthis was screened to evaluate its free-radical scavenging ability. The highest antioxidant and free radical scavenging effect of the fruit extract was observed at a concentration of 2500 µg mL1.Citrullus colocynthis (L.) Schrad. (Cucurbitaceae) je ljekovita biljka koja se tradicionalno upotrebljava kao abortiv i za liječenje konstipacije, edema, bakterijskih infekcija, karcinoma i dijabetesa. Preliminarno fitokemijsko pretraživanje ukazalo je na prisutnost velikih količina fenola i flavonoida. Udio fenola bio je 0,74% (preračunato na galnu kiselinu), a flavonoida 0,13% preračunato na ekvivalente katehina na 100 g svježe mase. Zbog prisutnosti fenolnih spojeva ispitivano je antioksidativno djelovanje i sposobnost hvatanja slobodnih radikala metanolnog ekstrakta plodova. Koncentracija 2500 µg mL1 imala je najjači učinak

Cytisus scoparius link - A natural antioxidant

BACKGROUND: Recent investigations have shown that the antioxidant properties of plants could be correlated with oxidative stress defense and different human diseases. In this respect flavonoids and other polyphenolic compounds have gained the greatest attention. The plant Cytisus scoparius contains the main constituent of flavone and flavonals. The present study was undertaken to evaluate the in vitro antioxidant activities of extract of aerial part of Cytisus scoparius. METHODS: The plant extract was tested for DPPH (1, 1-diphenyl, 2-picryl hydrazyl) radical scavenging, nitric oxide radical scavenging, superoxide anion radical scavenging, hydroxyl radical scavenging, antilipid peroxidation assay, reducing power and total phenol content. RESULTS: The extract exhibited scavenging potential with IC(50 )value of 1.5 μg/ml, 116.0 μg/ml and 4.7 μg/ml for DPPH, nitric oxide and superoxide anion radicals. The values were found to lesser than those of vitamin C, rutin, and curcumin, as standards. The extract showed 50% protection at the dose of 104.0 μg/ml in lipid peroxidation induced by Fe(2+)/ ascorbate system in rat liver microsomal preparation. There is decrease in hydroxyl radical generation with IC(50 )value of 27.0 μg/ml when compared with standard vitamin E. The reducing power of the extract depends on the amount of extract. A significant amount of polyphenols could be detected by the equivalent to 0.0589 μg of pyrocatechol from 1 mg of extract. CONCLUSION: The results obtained in the present study indicate that hydro alcoholic extract of aerial part of Cytisus scoparius is a potential source of natural antioxidants

Trace elements in glucometabolic disorders: an update

Many trace elements, among which metals, are indispensable for proper functioning of a myriad of biochemical reactions, more particularly as enzyme cofactors. This is particularly true for the vast set of processes involved in regulation of glucose homeostasis, being it in glucose metabolism itself or in hormonal control, especially insulin. The role and importance of trace elements such as chromium, zinc, selenium, lithium and vanadium are much less evident and subjected to chronic debate. This review updates our actual knowledge concerning these five trace elements. A careful survey of the literature shows that while theoretical postulates from some key roles of these elements had led to real hopes for therapy of insulin resistance and diabetes, the limited experience based on available data indicates that beneficial effects and use of most of them are subjected to caution, given the narrow window between safe and unsafe doses. Clear therapeutic benefit in these pathologies is presently doubtful but some data indicate that these metals may have a clinical interest in patients presenting deficiencies in individual metal levels. The same holds true for an association of some trace elements such as chromium or zinc with oral antidiabetics. However, this area is essentially unexplored in adequate clinical trials, which are worth being performed

Development of polymorphic microsatellite loci in Nothapodytes nimmoniana, a medicinally important tree from the Western Ghats, India.

Nothapodytes nimmoniana is a medicinally important tree species that occur in the Western Ghats, a megadiversity hotspot in southern India. Inner stem bark of the tree contains an important anti-cancer alkaloid, camptothecin for which the natural population of the tree is heavily harvested. In this paper, we report the isolation and characterization of eight polymorphic microsatellite loci using enrichment hybridization protocol. Analysis of 36 individuals representing two populations revealed three to 12 alleles per locus. Observed heterozygosity ranged from 0.21 to 0.94 for the two populations. None of the loci tested showed linkage disequilibrium. These markers are invaluable for evaluating the genetic structure and assessing the genetic impacts of harvesting of N. nimmoniana in the Western Ghats to formulate strategies for conservation of the species

Assessing species admixtures in raw drug trade of Phyllanthus, a hepato-protective plant using molecular tools

Ethnopharmacological relevance: Phyllanthus (Euphorbiaceae) species are well known for their hepatoprotective activity and are used in several ethno-medicines in indigenous health care systems in India. Aim of the study: To assess species admixtures in raw drug trade of Phyllanthus using morphological and DNA barcoding tools. Materials and methods: Samples of Phyllanthus used in raw drug trade were obtained from 25 shops in southern India. Species admixtures in the samples were assessed by identifying species using morphotaxonomic keys. These identities were further validated by developing species specific DNA barcode signatures using the chloroplast DNA region, psbA-trnH. DNA from the market samples were extracted and amplified using the forward (psbAF GTTATGCATGAACGTAATGCTC) and reverse primer (trnHR – CGCGCATGGTGGATTCACAAATC). The amplified products were sequenced at Chromous Biotech India, Bangalore. The sequences were manually edited using Chromas Lite. Species identities were established by constructing a neighbor-joining tree using MEGA V 4.0. Results: Morphological analysis of market samples revealed six different species of Phyllanthus in the trade samples. Seventy-six percent of the market samples contained Phyllanthus amarus as the predominant species (>95%) and thus were devoid of admixtures. The remaining 24% of the shops had five different species of Phyllanthus namely Phyllanthus debilis, Phyllanthus fraternus, Phyllanthus urinaria, Phyllanthus maderaspatensis, and Phyllanthus kozhikodianus. All identities, except those for Phyllanthus fraternus, were further confirmed by the species specific DNA barcode using chloroplast region psbA-trnH. Conclusion: Our results show that market samples of Phyllanthus sold in southern India contain at least six different species, though among them, Phyllanthus amarus is predominant. DNA barcode, psbA-trnH region of the chloroplast can effectively discriminate Phyllanthus species and hence can be used to resolve species admixtures in the raw drug trade of Phyllanthus