Silodosin inhibits noradrenaline-activated transcription factors Elk1 and SRF in human prostate smooth muscle.

The transcription factors Elk1 and serum response factor (SRF) are central regulators of cell cycle and phenotype in various cell types. Elk1 is activated by phosphorylation (serine-383), while activation of SRF requires its co-factor, myocardin. Activation of Elk1 and SRF results in binding to specific DNA sequences in promoter regions, and may be induced by adrenergic receptor activation in different organs. To examine the effects of adrenergic stimulation on Elk1 and SRF in the human prostate and the ability of the highly selective α1A-adrenoceptor antagonist, silodosin, on transcription factor activation. Prostate tissue was obtained from patients undergoing radical prostatectomy. Expression of Elk1, SRF, and myocardin was estimated by Western blot and immunohistochemistry. Colocalizations were studied by double immunofluorescence staining. Noradrenaline- (NA-) and phenylephrine- (PE-) induced phosphorylation of Elk1 was assessed by Western blot analysis using a phospho-specific antibody. NA-induced activation of Elk1 and SRF was investigated by electrophoretic mobility shift assay (EMSA). Immunoreactivity for Elk1, SRF, and myocardin was observed in stromal cells of tissues from each patient. In fluorescence stainings, SRF colocalized with myocardin and α-smooth muscle actin (αSMA). Stimulation of prostate tissues with PE (10 µM) or NA (30 µM) increased the phosphorylation of Elk1 at serine-383. NA-induced Elk1 activation was confirmed by EMSA, where a NA-induced binding of Elk1 to the DNA sequence TTTGCAAAATGCAGGAATTGTTTTCACAGT was observed. Similarly, NA caused SRF binding to the SRF-specific DNA sequence CCATATTAGGCCATATTAGG. Application of silodosin (3 µM) to prostate tissues reduced the activity of Elk1 and SRF in NA-stimulated tissues. Silodosin blocks the activation of the two transcription factors, Elk1 and SRF, which is induced by noradrenaline in the human prostate. A role of α1-adrenoceptors beyond smooth muscle contraction may be considered, which includes a function in transcriptional regulation

The cAMP effector EPAC activates Elk1 transcription factor in prostate smooth muscle, and is a minor regulator of alpha 1-adrenergic contraction

Background: Prostate smooth muscle tone is regulated by alpha 1-adrenoceptor-induced contraction and cAMP-mediated relaxation. EPAC is an effector of cAMP, being involved in smooth muscle relaxation and cell cycle control outside the lower urinary tract. Here, we investigated the expression and function of EPAC in human prostate tissues from patients undergoing radical prostatectomy. Results: mRNA and protein expression of EPAC was detected in all prostate tissues by RT-PCR and Western blot analysis. Immunoreactivity was observed in stromal cells, and colocalized with immunofluorescence for a-smooth muscle actin and calponin. Under normal conditions, noradrenaline-or phenylephrine-induced contraction of prostate strips in the organ bath was not affected by the EPAC activator pCPT (SP-8-pCPT-2'-O-Me-cAMPS.NA) (30 mu M). However, when the cyclooxygenase inhibitor indomethacin (50 mu M) was added, EPAC activators pCPT and OME (8-CPT-2'-O-Me-cAMP.Na) (30 mu M) significantly reduced contractions by low concentrations of phenylephrine. These effects were not observed on noradrenaline-induced contraction. OME and pCPT caused phosphorylation of the transcription factor Elk1 in prostate tissues. Elk1 activation was confirmed by EMSA (electrophoretic mobility shift assay), where OME and pCPT incresed Elk1 binding to a specific DNA probe. Conclusions: EPAC activation may reduce alpha 1-adrenergic prostate contraction in the human prostate, although this effect is masked by cyclooxygenases and beta-adrenoceptors. A main EPAC function in the human prostate may be the regulation of the transcription factor Elk1

Adult patients after coarctation of the aorta repair - exercise induced hypertension

Wstęp U większości pacjentów po skutecznej operacji koarktacji aorty (CoAo, coarctation of aorta) obserwuje się nadciśnienie tętnicze, a części z nich nadciśnienie tętnicze indukowane wysiłkiem. Celem pracy była ocena spiroergometryczna wydolności wysiłkowej oraz echokardiograficzna ocena wielkości masy lewej komory (LVM, left ventricular mass) u dorosłych chorych po chirurgicznej korekcji CoAo w zależności od obecności nadciśnienia tętniczego, ze szczególnym uwzględnieniem osób z nadciśnieniem tętniczym indukowanym wysiłkiem. Materiał i metody Badano 74 pacjentów (29 kobiet) w średnim wieku 31,2 ± 9,8 roku operowanych w średnim wieku 10,4 ± 6,8 roku. Grupę kontrolną stanowiło 30 osób (12 kobiet) w średnim wieku 32,2 ± 6,6 roku. Badaniem echokardiograficznym oceniono LVM i wskaźnik masy lewej komory (LVMI, LVM index). Wykonano maksymalny test wysiłkowy na bieżni ruchomej według zmodyfikowanego protokółu Bruce’a oraz spirometrię spoczynkową, oceniając szczytowe pochłanianie tlenu (peak VO2), wskaźnik wentylacji do perfuzji (VE/VCO2, ventilation volume to CO production). Określono wartości spoczynkowego i wysiłkowego ciśnienia tętniczego. Za nadciśnienie tętnicze indukowane wysiłkiem uznano ciśnienie skurczowe na szczycie wysiłku powyżej 200 mm Hg u pacjenta z prawidłowymi wyjściowymi wartościami ciśnienia tętniczego. Wyniki Odnotowano: brak nadciśnienia (32 osoby), nadciśnienie tętnicze utrwalone (31) i nadciśnienie tętnicze indukowane wysiłkiem (10). U chorych z nadciśnieniem tętniczym indukowanym wysiłkiem stwierdzono mniejszą konsumpcję szczytową tlenu (p = 0,01) i większy VE/VCO2 (p = 0,01) niż u pacjentów bez tego schorzenia. Wartości LVM oraz LVMI u osób z nadciśnieniem tętniczym indukowanym wysiłkiem były większe niż u chorych bez tego schorzenia (odpowiednio: p = 0,03 i p = 0,04). Wnioski 1. U dorosłych pacjentów po operacji CoAo z nadciśnieniem tętniczym indukowanym wysiłkiem oraz u osób z utrwalonym nadciśnieniem tętniczym zaobserwowano występowanie negatywnych czynników rokowniczych pod postacią upośledzenia tolerancji wysiłku oraz powiększenia LVM. 2. Powyższe obserwacje sugerują, że chorzy po operacji koarktacji aorty z nadciśnieniem tętniczym indukowanym wysiłkiem wymagają szczególnej wnikliwej obserwacji w celu ustalenia ewentualnych wskazań do wczesnego wdrożenia leczenia przeciwnadciśnieniowego.Background The majority of the patients after successful operation of coarctation of the aorta (CoAo) suffer from arterial hypertension (AH) and some from exercise induced arterial hypertension (AHex). The aim of the study was evaluate exercise capacity in cardiopulmonary exercise test and left ventricular mass on echocardiography examination in adult patients after surgical repair of CoAo according to presence of AH and AHex. Material and methods the analysis of 74 patients (29 females) aged 31.2 ± 9.8 years operated at mean age 10.4 ± 6.6 years. Control group: 30 volunteers (12 females) aged 32.2 ± 6.6 years. On echocardiography LV mass (LVM) and LV mass index (LVMI) were calculated. All patients performed a maximal, symptom-limited treadmill exercise test according to modified Bruce protocol. The maximal oxygen consumption (peak VO2), ventilation/carbon dioxide slope (VE/ /VCO2) were measured. Arterial hypertension was measured at rest and during max. exercise. AHex was defined as systolic pressure at peak exercise > 200 mm Hg in patients with initially normal blood pressure. Results without AH (AH–) - 32 patients, AH - 31 patients, AHex - 10 patients. AHex patients had lower peak VO2 (p = 0.01), higher VE/VCO2 (p = 0.01) than AH(–) LVM and LVMI in AHex group were greater than in AH(–) group (respectively p = 0.03 and p = 0.04). Conclusions 1. Adult patients after operation of CoAo with AHex have similar negative risk factors: lower exercise capacity and LV enlargement of as patients with persistent AH. 2. Above results suggest that patients after operation of CoAo with AHex need special insightful observation. Additionary research are necessary to establish potential indication for early antihypertension treatment in this group of patients

Ghrelin Aggravates Prostate Enlargement in Rats with Testosterone-Induced Benign Prostatic Hyperplasia, Stromal Cell Proliferation, and Smooth Muscle Contraction in Human Prostate Tissues

Epidemiologic studies revealed a context between lower urinary tract symptoms (LUTS) suggestive of benign prostatic hyperplasia (BPH) and metabolic syndrome. However, molecular mechanisms underlying this relationship are largely unknown. Prostate enlargement and increased prostate smooth muscle tone are important factors in the pathophysiology of LUTS suggestive of BPH. In the present study, we studied effects of the metabolic hormone ghrelin on prostate enlargement in rats with experimentally induced BPH, growth of cultured stromal cells from human prostate (WPMY-1), and smooth muscle contraction of human prostate tissues. Ghrelin (20 nmol/kg daily, p.o., 2 weeks) increased prostate size in rats with testosterone-induced BPH. Microarray identified 114 ghrelin-upregulated genes (2-fold or more) in these prostates, with possible roles in growth, smooth muscle contraction, or metabolism. 12 genes were selected for further analyses. In human prostate tissues, mRNA levels of 11 of them correlated positively with ghrelin receptor (GHSR) expression, but only two with the degree of BPH. Accordingly, no correlation was evident between GHSR expression level and BPH in human prostate tissues. In WPMY-1 cells, the GHRS agonist MK0677 upregulated 11 of the selected genes. MK0677 induced proliferation of WPMY-1 cells, shown by EdU assay, colony formation, proliferation markers, flow cytometry, and viability. In myographic measurements, GHSR agonists enhanced contractions of human prostate strips. Together, ghrelin may aggravate prostate enlargement, stromal cell growth, and prostate smooth muscle contraction in BPH. Ghrelin may deteriorate urethral obstruction independently from BPH, qualifying the ghrelin system as an attractive new target to be tested for LUTS treatment in BPH

Evaluation of antihypertensive effect and tolerance of ramipril (Polpril) in patients with essential mild/moderate arterial hypertension

Wstęp Nadciśnienie tętnicze jest uznanym, niezależnym czynnikiem ryzyka chorób sercowo-naczyniowych. Podwyższone wartości ciśnienia tętniczego zwiększają śmiertelność sercowo-naczyniową oraz wiążą się z częstszym występowaniem zawału serca i udaru mózgu oraz uszkodzeniem nerek. Zaobserwowano, że w godzinach porannych częściej dochodzi do wystąpienia zawału serca czy udaru mózgu. Wynika z tego konieczność kontroli ciśnienia tętniczego przez całą dobę, a w szczególności w godzinach porannych. Z badań populacyjnych wynika, że jakość życia (HRQoL) chorych na pierwotne nadciśnienie tętnicze zarówno leczonych, jak i nieleczonych jest niższa 10&#8211;20% od odpowiadających im wiekiem osób zdrowych. Celem badania była ocena skuteczności hipotensyjnej ramiprilu w pomiarach gabinetowych i podczas 24-godzinnego pomiaru ciśnienia tętniczego oraz częstości wystąpienia objawów niepożądanych i jakości życia pacjentów w trakcie terapii ramiprilem. Materiał i metody Do badania włączono 100 pacjentów w wieku 25-70 lat (średnia wieku 42,9 &#177; 8,2 roku) z nadciśnieniem tętniczym nowo wykrytym lub nieleczonym przez okres co najmniej 3 miesięcy. Terapię hipotensyjną rozpoczynano od dawki 5 mg dziennie ramiprilu. Po 4 tygodniach aktywnego leczenia, gdy SBP > 140 mm Hg i/lub DBP > 90 mm Hg dawkę ramiprilu podwajano. Przeprowadzono 3-krotny pomiar ciśnienia tętniczego sfigmomanometrem automatycznym oraz za pomocą aparatu do 24-godzinnego pomiaru ciśnienia. Oceniono samopoczucie pacjenta w skali od 1 do 6. Wyniki Podczas badania zaobserwowano istotny spadek SBP i DBP mierzonego metodą tradycyjną (13,27/9,12 mm Hg). Potwierdzono również istotną redukcję BP podczas badania ABPM (p < 0,001). Podczas terapii ramiprilem obserwowano znamienną poprawę samopoczucia pacjentów oraz spadek stężenia cholesterolu frakcji LDL oraz wzrost stężenia frakcji HDL. Wnioski Ramipril stosowany w monoterapii wykazał silny efekt hipotensyjny w ciągu 24 godzin. Terapia ramiprilem była dobrze tolerowana przez pacjentów. Nadciśnienie Tętnicze 2010, tom 14, nr 6, strony 434-442Background Arterial hypertension is a known, independent risk factor of cardiovascular disease. Elevated values of blood pressure (BP) increase cardiovascular mortality and are related to higher risk of myocardial infarction, stroke and kidney failure. It was observed that myocardial infarction and stroke occur more often in the early morning hours. Previous studies have shown that health-related quality of life is approximately 10-20% decreased in patients with treated and untreated arterial hypertension compared to healthy patients. The aim of the study was to determine the effects of ramipril on arterial blood pressure in the office blood pressure measurements and 24-h ambulatory blood pressure monitoring and evaluation of prevalence of the side effects and quality of life during therapy with ramipril. Material and methods 100 patients with primary, mildmoderate arterial hypertension diagnosis based on traditional measurements were qualified for research. Patients aged 25 to 70 (mean age 42.9 &#177; 8.2) have been studied. Antihypertensive therapy was based on ramipril (5 mg daily). After 4 weeks of antihypertensive therapy if SBP > 140 and/or DBP > 90 mm Hg, dose of ramipril was doubled. Office BP measurements and ABPM were performed. Evaluation of the subjective wellbeing was taken. Results During the study significant decrease of SBP and DBP in the office measurements were observed (13.27/9.12 mm Hg). We also confirmed reduction of BP in 24-h ABPM (p < 0.001). We observed significant improvement of the general feeling and LDL and HDL level. Conclusion Ramipril administered in monotherapy has strong hypotensive effect during 24-hours. Therapy with ramipril was well tolerated by the patients. Arterial Hypertension 2010, vol. 14, no 6, pages 434-44

Purinergic smooth muscle contractions in the human prostate: estimation of relevance and characterization of different agonists

Non-adrenergic prostate smooth muscle contractions may account for the limited effectiveness of α1-adrenoceptor antagonists, which are the first-line option for medical treatment of voiding symptoms suggestive of benign prostatic hyperplasia. In non-human prostates, purinergic agonists induce contractions reaching similar magnitudes as α1-adrenergic contractions. However, evidence for the human prostate is highly limited, and pointed to much weaker purinergic contractions. Here, we examined contractions of different purinergic agonists in human prostate tissues. Tissues were obtained from radical prostatectomy. Contractions were studied in an organ bath, and expression of purinergic receptors was studied by RT-PCR. Electric field stimulation (EFS)-induced contractions amounted to 104% of KCl-induced contractions (95% CI: 84-124%). From all tested agonists, only ATP induced concentration-dependent contractions, reaching an average maximum of 18% (12-24%) of KCl. Maximum tensions following application of other agonists averaged to 7.1% of KCl for α,β-methylene-ATP (1.8-12.4%), 3.9% for β,γ-methylene-ATP (2.0-5.4%), 3.1% for 2-methylthio-ATP (- 0.1-6.3%), and 5.1% for ATPγS (1.0-9.2%). Responses were not affected by the P2X antagonist NF023 or the P2Y antagonist PPADS. mRNA expression of P2X1-4 correlated with expression of a marker for catecholaminergic nerves, although neither ATP, NF023, nor PPADS changed EFS-induced contractions. Correlation between expression of receptors and the smooth muscle marker calponin was not observed. Our findings point to a low relevance of purinergic contractions in the human prostate, compared to other contractile stimuli in the human prostate and compared to purinergic contractions in non-human prostates. Purinergic contractions in the human prostate are not sensitive to NF023 or PPADS

P21-Activated Kinase Inhibitors FRAX486 and IPA3: Inhibition of Prostate Stromal Cell Growth and Effects on Smooth Muscle Contraction in the Human Prostate

Prostate smooth muscle tone and hyperplastic growth are involved in the pathophysiology and treatment of male lower urinary tract symptoms (LUTS). Available drugs are characterized by limited efficacy. Patients' adherence is particularly low to combination therapies of 5 alpha-reductase inhibitors and alpha(1)-adrenoceptor antagonists, which are supposed to target contraction and growth simultaneously. Consequently, molecular etiology of benign prostatic hyperplasia (BPH) and new compounds interfering with smooth muscle contraction or growth in the prostate are of high interest. Here, we studied effects of p21-activated kinase (PAK) inhibitors (FRAX486, IPA3) in hyperplastic human prostate tissues, and in stromal cells (WPMY-1). In hyperplastic prostate tissues, PAK1, -2, -4, and -6 may be constitutively expressed in catecholaminergic neurons, while PAK1 was detected in smooth muscle and WPMY-1 cells. Neurogenic contractions of prostate strips by electric field stimulation were significantly inhibited by high concentrations of FRAX486 (30 mu M) or IPA3 (300 mu M), while noradrenaline-and phenylephrine-induced contractions were not affected. FRAX486 (30 mu M) inhibited endothelin-1- and -2-induced contractions. In WPMY-1 cells, FRAX486 or IPA3 (24 h) induced concentration-dependent (1-10 mu M) degeneration of actin filaments. This was paralleled by attenuation of proliferation rate, being observed from 1 to 10 mu M FRAX486 or IPA3. Cytotoxicity of FRAX486 and IPA3 in WPMY-1 cells was time-and concentration-dependent. Stimulation of WPMY-1 cells with endothelin-1 or dihydrotestosterone, but not noradrenaline induced PAK phosphorylation, indicating PAK activation by endothelin-1. Thus, PAK inhibitors may inhibit neurogenic and endothelin-induced smooth muscle contractions in the hyperplastic human prostate, and growth of stromal cells. Targeting prostate smooth muscle contraction and stromal growth at once by a single compound is principally possible, at least under experimental conditions

MODIL &#8212; wieloośrodkowe, randomizowane badanie porównujące moexipril i diltiazem w monoterapii i terapii skojarzonej nadciśnienia tętniczego

Background The aim of the study was to compare efficacy of moexipril or diltiazem in monotherapy and in combination antihypertensive therapy. Materials and methods 182 patients aged 30 do 70 years with mild to moderate essential hypertension were studied. If blood pressure was between 90 and 110 mm Hg for diastolic and between 140 and 190 mm Hg for systolic after 1 week run-in placebo phase, patients were randomized to receive moexipril in dose 7,5 mg/d or diltiazem in dose 120 mg/d, once a day. After 2 weeks, in case of poor blood pressure control patients were randomized second time to receive doubled dose of the drug in monotherapy or combination therapy with low dose of moexipril and diltiazem. Treatment was continued for next 8 weeks with blood pressure control after 4 and 8 weeks. Results Mean basic blood pressure was 160,6 &plusmn; 11,3 / 99,7 &plusmn; &plusmn; 5,2 mm Hg in moexipril group and 159,6 &plusmn; 10,5/98,7 &plusmn; &plusmn; 5,3 mmHg in diltiazem group. After 2 weeks treatment with low dose moexipril blood pressure decreased by 17/8 mm Hg (p < 0,001) and with diltiazem by 14/5 mm Hg. Efficacy (blood pressure below 140/90 mm Hg) of low dose moexipril was 45% and of low dose diltiazem 33%. Efficacy of combination therapy was significantly higher than monotherapy with doubled dose (33% vs 8% in moexipril group and 39% vs 23% in diltiazem group. Theoretically estimated effectiveness of antihypertensive strategy from low dose of calcium chanel blocker or ACE inhibitor to combination therapy with these drugs was 54,4%, and method from low dose to increased dose of single drug was 40,4 %. Side effects (hypothension, weakness, headache, dizziness and allergic skin reaction were noted in 3 patients. Conclusions Diltiazem SR and moexipril were proved to be effective, safe and well tolerated antihypertensive agents both in monotherapy and combination treatment. Combination therapy with low dose of calcium chanel blocker and ACE inhibitor is more effective than monotherapy with high dose of one of these drugs.Wstęp Celem badania było porównanie skuteczności hipotensyjnej moexiprilu i diltiazemu w monoterapii oraz terapii skojarzonej tymi lekami. Materiał i metody Badaniami objęto 182 pacjentów z nadciśnieniem tętniczym pierwotnym łagodnym lub umiarkowanym w wieku 30&#8211;70 lat, u których po tygodniu stosowania placebo ciśnienie rozkurczowe wynosiło 90&#8211;110 mm Hg włącznie i ciśnienie skurczowe 140&#8211;190 mm Hg włącznie. Pacjentów pochodzących z 6 ośrodków klinicznych w Polsce randomizowano do grupy otrzymującej moexipril w dawce 7,5 mg/d lub diltiazem 120 mg/d, 1 raz na dobę. Po 2 tygodniach, przy niewystarczającej reakcji hipotensyjnej, pacjentów ponownie randomizowano do grupy otrzymującej podwojoną dawkę leku hipotensyjnego w monoterapii lub do podgrupy otrzymującej terapię skojarzoną. Leczenie kontynuowano przez następne 8 tygodni, oceniając efekt hipotensyjny po 4 i 8 tygodniach. Wyniki Średnie wyjściowe ciśnienie tętnicze wynosiło 160,6 &plusmn; 11,3/99,7 &plusmn; 5,2 mm Hg w grupie leczonej moexiprilem i 159,6 &plusmn; 10,5/98,7 &plusmn; 5,3 mm Hg w grupie leczonej diltiazemem. Po 2 tygodniach leczenia uzyskano istotne obniżenie ciśnienia o 17/8 mm Hg (p < 0,001) pod wpływem moexiprilu oraz o 14/5 mm Hg (p < 0,001) po diltiazemie. Skuteczność hipotensyjna małej dawki moexiprilu wynosiła 45% i była większa niż małej dawki diltiazemu (33%). Skuteczność hipotensyjna po dodaniu drugiego leku była większa niż po zwiększeniu dawki leku w monoterapii i wynosiła 33% vs 8% w grupie leczonej wyjściowo moexiprilem oraz 39% vs 23% w grupie leczonej wyjściowo diltiazemem. Wyliczona teoretycznie skuteczność strategii leczenia hipotensyjnego od małej dawki inhibitora konwertazy lub antagonisty wapnia do terapii skojarzonej tymi lekami wynosiła 54,4%, a postępowania od małej do dużej dawki jednego z tych leków &#8212; 40,4%. Działania niepożądane w postaci hipotonii, osłabienia, bólów i zawrotów głowy oraz skórnej reakcji alergicznej zanotowano u 3 pacjentów. Wnioski Diltiazem SR i moexipril są skutecznymi, bezpiecznymi i dobrze tolerowanymi lekami zarówno w monoterapii, jak i skojarzonej terapii hipotensyjnej. Leczenie skojarzone niską dawką inhibitora konwertazy i antagonisty wapnia skuteczniej normalizuje ciśnienie krwi niż monoterapia podwojoną dawką jednego z tych leków

Inhibition of Prostate Smooth Muscle Contraction by Inhibitors of Polo-Like Kinases

Background: Prostate smooth muscle contraction plays an important role for pathophysiology and treatment of male lower urinary tract symptoms (LUTS) but is incompletely understood. Because the efficacy of available medication is limited, novel options and improved understanding of prostate smooth muscle contraction are of high demand. Recently, a possible role of polo-like kinase 1 (PLK1) has been suggested for smooth muscle contraction outside the lower urinary tract. Here, we examined effects of PLK inhibitors on contraction of human prostate tissue.Methods: Prostate tissues were obtained from radical prostatectomy. RT-PCR, Western blot and immunofluorescence were performed to detect PLK expression and phosphorylated PLK. Smooth muscle contractions were induced by electric field stimulation (EFS), α1-agonists, endothelin-1, or the thromboxane A2 analog U46619 in organ bath.Results: RT-PCR, Western blot, and immunofluorescence suggested expression of PLK1 in the human prostate, which may be located and active in smooth muscle cells. EFS-induced contractions of prostate strips were reduced by SBE 13 (1 μM), cyclapolin 9 (3 μM), TAK 960 (100 nM), and Ro 3280 (100 nM). SBE 13 and cyclapolin 9 inhibited contractions by the α1-agonists methoxamine, phenylephrine, and noradrenaline. In contrast, no effects of SBE 13 or cyclapolin 9 on endothelin-1- or U46619-induced contractions were observed.Conclusion: Alpha1-adrenergic smooth muscle contraction in the human prostate can be inhibited by PLK inhibitors. PLK-dependent signaling may be a new pathway, which promotes α1-adrenergic contraction of prostate smooth muscle cells. As contractions by endothelin and U46619 are not susceptible to PLK inhibition, this reflects divergent regulation of adrenergic and non-adrenergic prostate smooth muscle contraction