Distribution of Salt Marsh Plant Species in the Jaffna District, of Sri Lanka

Salt marsh plants are salt tolerant rooted vegetation that are found in low-energy transition zone between submerged and emerged environments, occupying the upper margins of the inter-tidal landscape. Salt marshes provide a unique habitat for a large number of species. Jaffna district harbors some of the major salt marshes in Sri Lanka, with large extents of undisturbed salt marshes. Salt marsh diversity and distribution has never been studied in Jaffna district since 1969 due to three-decade long armed conflict that prevailed in the entire northern part of Sri Lanka. The objective of the present study was to identify the dominant salt marsh plant species and their distribution in the Jaffna District. The study was conducted in the Jaffna District from 2014 to 2018. Line transects and spot-check methods were used to determine the distribution and abundance of salt marsh plant species. Distribution of salt marshes in the entire district was surveyed using GPS and the distribution maps were prepared using Q-GIS and ArcView. Then the distribution maps were intersected with Grama Niladhari division maps and salt marsh species distribution was evaluated by Grama Niladhari division level. Salt marsh plant species recorded in the present study are Suaeda maritima, S. vermiculata, S. monoica, Halosarcia indica and Salicornia brachiata. Total extent of the salt marshes in the Jaffna district was estimated to be around 1,105 hectares. Saltmarsh plant species are distributed in 25 Grama Niladhari divisions where large extents (over 100 ha) of salt marshes are found in 3 divisions (totaling 638 ha). Higher number of salt marsh species were found in Mandaitivu, Thanankilappu, Navali South, Arali- Navali, Ariyalai East and Chvachcheri. These species are found in in high salinity areas especially in southern and western parts of Jaffna main land and the islands. Salicornia brachiata is the most common species which was found in the entire study area. In the low salinity areas such as Vallai and Vatharavaththai small extents of salt marsh species were found. Jaffna salt marshes are one of the most overlooked coastal ecosystems. The study revealed that five salt marsh species, belonging to three families occur in the Jaffna District, distributed over a 18 number of Grama Niladhari divisions in Southern coastal line, 5 division in the Islands. At present, improper road constructions, hotel development, and lack of awareness on salt marsh ecosystems have negatively impacted on these ecosystems. Hence, more attention should be given to protect the salt marsh ecosystem and environmentally friendly development activities should be promoted to conserve them.Keywords: Salt marsh, Jaffna district, Grama Niladhari Divison, Mandaitivu, Saliconni

Species Diversity, Community Structure and Functions of Lagoon and Estuarine Mangrove Ecosystems in Pottuvil to Okanda Coastal Stretch in the East Coast of Sri Lanka

Studies on mangroves in Sri Lanka are mostly confined to the western, north-western and southern parts. Thus, the main objective of this study was to determine the distribution, abundance and diversity of true mangrove species, identify mangrove communities and calculate the carbon stocks of five mangrove ecosystems in the Eastern coast of Sri Lanka namely Pottuvil, Hada Oya, Ragamwela, Panama and Okanda. Mangroves were sampled using 84 randomly allocated 1010 m2 plots. True mangrove species were identified, height and diameter at breast height (dbh) of trees >10 cm dbh were recorded. Species density, frequency, dominance and different diversity indices were calculated. Plant communities were identified using multivariate analysis procedures. Biomass and carbon stocks were estimated using allometric equations. Soil samples were collected from top 0.3 m layer in five randomly selected locations in each plot. Pooled samples were used to determine soil organic carbon (loss on ignition method), salinity, conductivity, pH and total dissolved solutes. Light intensity below and away from the canopy was determined and net photosynthesis rate was estimated. Nine true mangroves were recorded in Panama estuarine lagoon and the least number of species (3) were recorded from Ragamwela creek. Highest Shannon diversity value (H’=1.7) and the lowest Simpson index (0.22) was obtained for the Panama mangrove. Nearly half of the true mangrove species (11) that have been recorded from Sri Lanka occurs in the five study sites. Seven different plant communities were identified in the analysis. Soil salinity showed a significant difference among sites, while pH did not vary very much. Highest total organic carbon was recorded in Pottuvil lagoon (558.4±131.8 t/ha), and the lowest in Ragamwela creek (200.9±38.5 t/ha). The highest above ground carbon was recorded in Hada Oya estuary (336.0±123.0 t/ha), while lowest in Ragamwela creek (76.1±60.2 t/ha). Net photosynthesis rates were similar among study sites, the highest was recorded in Hada Oya estuary (2,445.1±553.3 gcm-2/year). It can be concluded that the mangroves in the Eastern province have a moderate diversity with high carbon stock. However, as most mangroves are under different anthropogenic threats, it is immediately required to take measures to conserve them.Keywords: Mangrove ecosystem, Community structure, Species diversit

Ecology, Diversity and Conservation Priorities of Cave Dwelling Fauna in Mandaramnuwara Cave, Nuwara Eliya District

Cave biodiversity studies are scarce in Sri Lanka though caves support large number ofspecies. Formation of a cave takes thousands or millions of years. Mandaramnuwara cavewhich is a crystalline limestone cave comprised of beautiful formations of Stalactites. Thecave is located in the wet zone of Sri Lanka where the annual rainfall is between 2000-2500mm. Field studies were carried outfrom September 2012 to September 2013 to assess thediversity of bats, birds, herpatofauna and macroinvertebrates. Acave biodiversity databaseincluding species richness and description on cave fauna was developed to carry out anecological survey that will lead to identify the factors which contribute to cave fauna and toimprove cave fauna conservation.Throughout the study period transect walks were carried out inside the cave chambers andfauna were recorded in relation to their habitat occupation by direct observation. Randomsamples were taken for identification purposes. Cave environmental conditions such as lightintensity, temperature, humidity and pH of dripping waterwere recorded. The inner space ofthe cave has been separated into three large chambers. The entrance zone was mainlyoccupied by Pseudophilautus macropus. Breeding colony consisting of 34 nests ofAerodramus unicolor was observed in the twilight zone. Endemic snail Ravana politissimacolony was observed inside the dark zone. Cave crickets were the most abundant arthropod.Most abundant vertebrate species were Rhinolopus rouxii and Miniopterus schreibersii.Microchiropterans and the Indian swiftlet species prey upon insects contributing to the forestinsect population control. The recorded pH of the water inside the cave was 4.6. Humiditywas 84.3%. The average temperature was 19.6 °C. The information provided by the cavebiodiversity data base can be used as baseline information for cave fauna conservation andmanagement, cave eco-tourism and further investigations of cave habitats.

Change Detection in Protected Landscapes for Adaptive Protected Area Management A Practical Geoinformatics Approach

The Department of Wildlife Conservation (DWC), the entity which is entrusted with themandate to conserve fauna and flora of the country manages 14% of total land area of SriLanka, which are designated as Protected Areas (PA) under the Fauna and Flora ProtectionOrdinance (FFPO). Conservation of biodiversity and non destructive uses of wildliferesources especially for recreationl purposes within the PAs is a challanging task for theDWC. Horton Plains National Park is a one such PA which support higher diversity ofmontane fauna and flora in the country. The PA is at present also subjected some habitatchanges, which are taking place naturally. Managing such a sensitive landscape requrestimely and accuarare scientific information regarding the species richness of the area andtheir spatial and temporal distribution patterns. It is also important to understand the extent ofhabitat change, where it occurs and what habitats are converted into a different habitat.In conventional wildlife management approach thematic management plans are prepared fora ten year time frame. The review interval of such a plan is generally 5 years. However, in SriLankan context, due to the nature of the dynamics in protected areas and the taskenvironment, DWC uses a concept called “adaptive management” where the reviewing andadjustments of the activities are done frequently depending on the previous periods’experiences, usually less than five years. In this context temporal change detection of thehabitats is a task which should be carried out as frequent as possibleThis study focuses on developing classified vegetation map for two time periods (1998 and2008) and quntify the temporal area variation of the vegetation.Vegetation map wasdeveloped using IRS LISSA III images. The vegetation classes were classfied intoUndisturbed forest, Disturbed forest, Ecotone, Carpet Grass, Tussocky grass, and DwarfBamboo. The methodology was developed intergrating Normalize Difference VegitationIndex (NDVI) and Tasseled Cap Transformation. Finally the landscape of the PA wasclassified into different vegetation types using pixel based unsupervised classificationalgorithum. User and producer accuracies were calculated with the field observation data.The results clearly indicate that all the vegetation types within the PA have changed between1998 and 2008. Open forest cover increased from 23.56% to 28.41%, Marsh / dwarf bamboocover was increased from 5.35% to 8.76% during the period of ten years. It was also notedthat the dense forest areas are reduced from 48.19% to 47.52%, carpet grass dominant areareduced from 2.12% to 1.02% and tussock grass cover was reduced from 20.78% to 13.63%.In general forest cover of the PA has increased from 71.75% to 75.93% and grass cover(carpet and tussock) was reduced from 28.25% to 24.07% between 1998 and 2009 period.With the user accuracies of 83% in 1998 and 82% in 2008, and producer accuracy of 87% in1998 and 80% 2008 it can be concluded that the methodology adopted in the study issufficient in accuracy for practical usage. Hence, technique proposed in this study could bepracticed periodically to detect the vegetation changes quantitatively and effectively for themanagement activities of the park.

Lagoons in the East Coast; are They Potential Sites to Develop Fisheries in Sri Lanka

Lagoons are highly productive ecosystems which provide habitats and nursery grounds formany fish species and contribute to fisheries productions of a country. The status of fisheryin lagoons in the East coast has not been assessed in the past due to civil unrest in thecountry. This study was conducted in two lagoons in Ampara Distrcict; Panama and Pottuvil.The status of fishery was assesed over a six month period using data obtained from the dailycatch brought to the landing centres. Thirty five species of food fish, four species of shrimpsand the mangrove crab, Scylla serrata are harvested from the lagoons using different fishingmethods. The bulk of the food fish caught (63%) in the Panama lagoon were represented bySiganas lineatus, Oreochromis niloticus, Mugil cephalus, Gerres argyreus and Mystus guiliowhile only Oreochromis niloticus and Mugil cephalus contributed to a high percentage (59%)in the Pottuvil lagoon. The total productions of the Panama and Pottuvil lagoons wereestimated to be 74.05 kg/ha/yr and 67.48 kg/ha/yr respectively. The productivity is high inboth the lagoons compared to the average annual productivity of a Sri Lankan lagoon whichis about 22 kg/ha/yr. However, in comparison to the extent of the two lagoons (Panama 73haand Pottuvil 270ha), productivity of the Panama lagoon is significantly higher than that of thePottuvil lagoon (P=0.01) which makes Panama a potential site to develop lagoon fisheries inthe east coast. The extent of the mangrove vegetation (Panama 83ha and Pottuvil 46.6ha)with respect to the total surface area of the lagoons is a possible reason for the productivitydifference of the two lagoons. Both the lagoons show seasonal fluctuations due to rainfall andsalinity changes according to the Canonical Correspondence analysis that was performed andfish migration patterns have been observed in these lagoons. The life styles of the localpeople are highly dependent on lagoon fisheries in these areas thus; the environmental stressis higher on the ecosystem. Non regulation of net mesh sizes, destruction of mangroves,illegal land use and use of motor boats have caused certain environmental issues hence,suitable management practices should be introduced to ensure the sustainability of the lagoonecosystem

IMPACT OF MAHAWELI DIVERSION SCHEME ON BIOLOGICAL DIVERSITY OF DOWNSTREAM FLOOD PLAINS AND ASSOCIATED VillUS

Flood plains of Mahaweli River cover an area of 50,000 hectares. The flood plain extends fromthe river mouth in Trincomalee at its bottom end, to a little way south of the old settlement ofYakkure situated southwest of Manampitiya in the Polonnaruwa district. The flood plain iscomposed of various ecological zones consisting of river channels, villus(Riverine marshes) seasonally flooded grasslands and swamp forest. Villus are shallow andsaucer-shaped depressions on ground their water level is maintained by the annual cycle ofrainfall and river flooding. Most of these are directly connected to the Mahaweli River bychannels. There are 38 identified Villus located in the Mahaweli River floodplain system.A study program was initiated in early 2000 to evaluate the changes that are taking place in thebiotic components of this importantecosystem due to the Mahaweli Development activities suchas reservoir construction and water diversiou.Villus and floodplains have direct or indirect connection with the river or its tributaries. Whenthe river is high, water flows into the Villu or floodplains, and when the water level falls thereverse flow may occur towards the river. It was anticipated that upstream diversion schemes ofMahaweli River would reduce the river flow at Manampitiya by 50%. However fieldinvestigation carried out during our survey indicated that water levels of the Villus have notchanged significantly due to the diversion scheme.Accelerated Mahaweli program provided irrigation water for large areas of undeveloped landaround villus, thus converting them in to paddy fields. All These paddy field receive water forboth 'Yala' and 'Maha' rice growi l.g seasons. Today, vast extents of paddy fields drains in toVillus of the Mahaweli System. As a result, villus in the Mahaweli flood plain now receive ayear-round supply of water. Before the river diversion scheme villus received water from theriver only during the flooding season (i.e. January.) This has brought changes in the waterregimes of the villus.At the moment there is a booming development of Eichhomia crassipes (Japan jabara) due toexcessive loading of nutrients in villus.The study found that the river diversion schemes have resulted considerable changes in the biotaof the Villus and other ecosystems associated with the river. Therefore, steps should be taken torelease floodwater to Villus during the natural floor period of the river in order to sustain thenatural faunistic and floristic diversity in the villus and associated flood plains

Characterisation of Mitochondrial 12s rRNA Gene of Yellow Striped Chevrotain (Moschiola kathygre) and Development of a PCR-RFLP marker for the Unambiguous Identification of the Species

In the evolutionary studies of mammals, the study of Tragulids, commonly known as Chevrotains or mouse deer, is very important since they represent the basal branch of ruminants. They are the only members of the infraorder Tragulina and have not undergone significant changes since the Miocene period. Most of the Tragulids have become extinct leaving three genera to be found at present including, Tragulus, Hyemoschus, and Moschiola. The genus Moschiola consists of three species that can be found both in India (M. indica) and Sri Lanka (M. meminna and M. kathygre). The complete mitochondrial genome of Indian mouse deer has been sequenced recently but Sri Lankan mouse deer lacks molecular information. In the present study, the mitochondrial 12s rRNA gene sequence of Yellow striped Chevrotain (M. kathygre) was analysed with the objective of formulating a marker for the identification of the species. The genomic DNA from hair follicles was isolated and the 12s rRNA mitochondrial region was amplified using universal primers, forward primer 5’CAAACTGGGATTAGATACCCCACTAT 3’and reverse primer 5’GAGGGTGACGGGCGGTGTGT 3’. The sequence was compared with other deer species and the Indian Chevrotain. The Sri Lankan yellow striped chevrotain shared the highest sequence similarity of 91.19% with the Indian Chevrotain and above 89% similarity with other deer species. In silico analysis of 12s rRNA gene sequence revealed that a PCR-RFLP approach can be used to differentiate Yellow striped Chevrotain from the Indian Chevrotain using RsaI, BsrI, DraI and HinfI restriction enzymes.Keywords: Yellow striped chevrotain, Tragulids, 12s rRNA gene, PCR-RFL

Visual Techniques for the Determination of Age and Sex of Sambar Deer (Rusa unicolor unicolor) in Horton Plains National Park, Sri Lanka

A standard table was developed to facilitate the unambiguous identification of growth stages and gender of sambar deer (Rusa unicolor unicolor) calves from newborn to one year in Horton plains national park, Sri Lanka (HPNP). This was developed by evaluating the phenotypic characteristics of sambar deer calves (n=97±34) of known growth stages in 2018. A standard table was prepared based on their sex, shape of the snout, shape of the head and forehead between ears, size of the ears for the face, size of the neck, shape of the body, shape of the belly, shape of the back, size of the body and the behavior. The accuracy of the table was tested by using experienced people (n=30) who are regular visitors at HPNP. The average number of sambar deer in HPNP grassland in year 2018, during the study period was 919. In new born calves the accuracy of identification of gender was 83% and the accuracy of identification of growth phase was 87%. Identification of both sex and the growth phase of newborn calves simultaneously was 77% accurate. When the calves reach two weeks from birth, the accuracy of identifying their sex was increased to 93% whereas their growth phase was identified with 90% accuracy. The accuracy of identifying both sex and the growth phase simultaneously was 83% in calves two weeks after birth. When the calves reached five months from calving, the accuracy of identification of both sex and the growth phase increased to 100%. Calves at six months age, the identification of growth phase was 97% accurate. Accuracy of identifying of both gender and the growth phase simultaneously was 97%. In the sample between six months and one year the accuracy of identification of gender and growth phase was 95%. Starting from newborn stage to six months of age, the accuracy of identification based on the characters of the standard table increased steadily. However, upon reaching six months, there was a declination of identifying both gender and the growth phase of the sambar deer in HPNP simultaneously.Keywords: Sambar deer calves, Gender, Growth phase, Horton Plain

Preliminary Survey of Population Status of Diurnal Primates in the Giritale Nature Reserve, Sri Lanka

Declines in the numbers of many primate species have resulted from habitat destruction, human predation, capture of live animals for research, pet trade, or exhibition. Positive actions must be taken in order to assure the long-term survival of wild populations of primates. Population surveys of primates are central importance to many conservation actions. The aim of this preliminary study was to estimate population densities of three species of diurnal primates in the Giritale Nature Reserve. Surveys were conducted from December 2017 to January 2018 using the Reconnaissance Transect method. All three-monkey species live sympatrically in the nature reserve resembling their multi-malemulti-female troop structure. Mean troop sizes were recorded as 9.00±1.73, 21.60±6.73 and 24.50±16.3 for Semnopithecus vetulus philbricki, Semnopithecus priam thersites and Macaca sinica sinica respectively. Highest individual density recorded in M. s. sinica, which was 172.94 Individuals/km2, whereas lowest was 31.76 Individuals/km2 for S. v. philbricki. Male to female ratio was 1:1 in M. s. sinica (x2=0.0363; df=1; p=3.841) whereas, in S. p. thersites it was 3:7 (x2=df=1 p=3.841) and in S. v. philbrickiit was 2:3 (x2=3.071; df=1; p=3.841). The maximum recruitment rate index (RRI) is shown by M. s. sinica (0.12) whereas the minimum is shown by S. p. thersites (0.05). Variations of ratios of male-female and RRI depends on conditions like infanticide, mother or sisterhood care, predator pressure and physiological state of the young ones. The survey was provided new, broad and accurate information on population density and troop structure to assess the status of these three monkey species in the nature reserve. Threat analysis and ecological studies can be conducted as future implements. This can be vital to implement conservation priorities and create management plans for the populations on a larger scale.Keywords: Population status, Diurnal primates, Giritale Nature Reserv

Population Size, Plant Occupancy and Threats to Acavus in Three Selected Homegardens in Kandy District, Sri Lanka

Acavus is an endemic genus of arboreal land snails, widely distributed in south west wet zoneof Sri Lanka. Acavus consist of three species, Acavus haemastoma, Acavus superbus andAcavus phoenix with two subspecies Acavus phoenix phoenix and Acavus phoenix custaneus.Although Acavus is an endemic Gondwanan relict there are only few studies carried out onthese snails, especially focusing homegardens. Homegardens serve as islands of habitatsmaintaining a considerable portion of Acavus. The objectives of the study are to estimate thepopulation size of Acavus, to study the tree species commonly occupied by Acavus and toidentify the threats to Acavus in homegardens in Kandy district. Study was carried out inthree homegardens (each with about 60 perches) in Kahalla, Pilimathalawa and Gampola forsix months from February to July 2013. All the sites harboured Acavus phoenix custaneus.Each site was visited twice a month and total count of Acavus and tree species they occupiedwere recorded. Threats to Acavus also observed in the field. Sites that were studied showedbasic characters of Kandyan homegardens. According to the results, population sizes ofAcavus of the sites are as follows, Kahalla 181, Pilimathalawa 40 and Gampola 117. Of theAcavus observed highest percentages were observed associated with following tree species,Areca catechu (24.29%), Artocarpus heterophyllus (15.91%), Cocos nucifera (12.78%),Michelia champaca (7.78%), Persea Americana (5.35%), Musa spp. (3.31%), Coffea arabica(2.87%), Gliricidia sepium (2.57%), Caryota urens (2.52) and Artocarpus altilis (1.92%).Rest of the Acavus observed was distributed in a variety of other tree and shrub species. Inhomegardens Acavus is threatened mainly by greater coucal (Centropus sinensis),occasionally by toque monkey (Macaca sinica), shrinking of homegardens (as they pass fromgeneration to generation) and unawareness of public. It is clear that the presence of certaintree and shrub species supports the survival of Acavus in homegardens and sustainable use ofsuch flora will help to maintain healthy Acavus populations.