Identificação de fungos em linhaça ( Linum usitatissimum ) utilizando as regiões ITS1 e ITS2 do gene ITS

TCC (graduação) - Universidade Federal de Santa Catarina. Centro de Ciências Agrárias. Ciência e Tecnologia de Alimentos.A semente de linhaça (Linum usitatissimum L.) é conhecida por suas propriedades funcionais e presença de ácido α-linolênico (ômega-3). Contém ainda fibra solúvel e insolúvel, lignanas, ácidos fenólicos, flavonoides, ácido fítico, vitaminas e minerais. Todavia, a microbiota deste alimento pode ser foco de contaminação fúngica, interferindo na qualidade final. O objetivo deste trabalho foi identificar os fungos presentes em linhaça a granel através do gene ITS em uma abordagem metagenômica. A identificação fúngica foi realizada utilizando-se o sequenciamento de alto desempenho da região ITS1 usando os primers ITS1 (GAACCWGCGGARGGATCA) e ITS2 (GCTGCGTTCTTCATCGATGC) com 300 ciclos e sequenciamento single-end no equipamento MiSeq Sequencing System (Illumina Inc., USA). Foram encontrados seis gêneros e oito espécies de fungos na amostra de linhaça dourada analisada. O gênero Aspergillus se destacou com três espécies xerofílicas encontradas, A. cibarius, A. Appendiculatus e A. amstelodami. Aspergillus cibarius foi a mais abundante, porém não produz toxinas. O segundo gênero mais abundante foi Wallemia, com a espécie W. muriae. Este é um dos táxons de fungos com grande potencial xerofílico, sendo que algumas cepas podem produzir toxinas. A metagenômica revelou ser um método completo, rápido e eficiente, principalmente quando comparado a outros métodos como por exemplo, o de cultivo tradicional exercido em laboratório. O sequenciamento genético de alto desempenho é um importante aliado nas pesquisas, com o avanço tecnológico relacionado a segurança dos alimentos.Flaxseed (Linum usitatissimum L.) is known for its functional properties and presence of α linolenic acid (omega-3). It also contains soluble and insoluble fiber, lignans, phenolic acids, flavonoids, phytic acid, vitamins and minerals. However, the microbiota of this food can be the focus of fungal contamination, interfering with the final quality. The objective of this work was to identify the fungi present in bulk flaxseed through the ITS1 gene by using a metagenomics approach. Fungal identification was performed using the high performance sequencing of the ITS1 region using the ITS1 (GAACCWGCGGARGGATCA) and ITS2 (GCTGCGTTCTTCATCGATGC) primers with 300 cycles and single-end sequencing in the MiSeq Sequencing System equipment (Illumina Inc., USA). Six genera and eight species of fungi were found in the golden linseed sample. The genus Aspergillus stood out with three xerophilic species found, A. cibarius, A. Appendiculatus and A. amstelodami. Aspergillus cibarius was the most abundant, but it does not produce toxins. The second most abundant genus was Wallemia, with the species W. muriae. This is one of the fungi taxa with great xerophilic potential, and some strains can produce toxins (Walleminol and Walleminon). Metagenomics has proved to be a complete, fast and efficient method, especially when compared to other methods, such as traditional cultivation performed in the laboratory. High-performance genetic sequencing is an important ally in research, with technological advances related to food safety

Identification of Fungi in Flaxseed (L. usitatissimum L.) Using the ITS1 and ITS2 Intergenic Regions

Flaxseed (Linum usitatissimum L.) displays functional properties and contains α-linolenic acid (omega-3). It also contains soluble and insoluble fiber, lignans, phenolic acids, flavonoids, phytic acid, vitamins, and minerals. However, its microbiota can cause fungal contaminations, drastically reducing its quality. The objective of this work was to identify the fungi present in bulk flaxseed through the internal transcribed spacer (ITS1) intergenic region using a metataxonomics approach. Fungal identification was performed via high-performance sequencing of the ITS1 region using ITS1 (GAACCWGCGGARGGATCA) and ITS2 (GCTGCGTTCTTCATCGATGC) as primers with 300 cycles and single-end sequencing in the MiSeq Sequencing System equipment (Illumina Inc., San Diego, CA, USA). Six genera and eight species of fungi were found in the sample. The genus Aspergillus stood out with three xerophilic species found, A. cibarius, A. Appendiculatus, and A. amstelodami, the first being the most abundant. The second most abundant genus was Wallemia, with the species W. muriae. This is one of the fungi taxa with great xerophilic potential, and some strains can produce toxins. Metataxonomics has proved to be a complete, fast, and efficient method to identify different fungi. Furthermore, high-performance genetic sequencing is an important ally in research, helping to develop novel technological advances related to food safety

Identification of Fungi in Flaxseed (<i>L. usitatissimum</i> L.) Using the ITS1 and ITS2 Intergenic Regions

Flaxseed (Linum usitatissimum L.) displays functional properties and contains α-linolenic acid (omega-3). It also contains soluble and insoluble fiber, lignans, phenolic acids, flavonoids, phytic acid, vitamins, and minerals. However, its microbiota can cause fungal contaminations, drastically reducing its quality. The objective of this work was to identify the fungi present in bulk flaxseed through the internal transcribed spacer (ITS1) intergenic region using a metataxonomics approach. Fungal identification was performed via high-performance sequencing of the ITS1 region using ITS1 (GAACCWGCGGARGGATCA) and ITS2 (GCTGCGTTCTTCATCGATGC) as primers with 300 cycles and single-end sequencing in the MiSeq Sequencing System equipment (Illumina Inc., San Diego, CA, USA). Six genera and eight species of fungi were found in the sample. The genus Aspergillus stood out with three xerophilic species found, A. cibarius, A. Appendiculatus, and A. amstelodami, the first being the most abundant. The second most abundant genus was Wallemia, with the species W. muriae. This is one of the fungi taxa with great xerophilic potential, and some strains can produce toxins. Metataxonomics has proved to be a complete, fast, and efficient method to identify different fungi. Furthermore, high-performance genetic sequencing is an important ally in research, helping to develop novel technological advances related to food safety